ID: 990343578

View in Genome Browser
Species Human (GRCh38)
Location 5:54849343-54849365
Sequence GGAGGCATTAAGTGCATCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990343575_990343578 19 Left 990343575 5:54849301-54849323 CCTTGTATCAACACTTTGCATGT No data
Right 990343578 5:54849343-54849365 GGAGGCATTAAGTGCATCCTAGG No data
990343574_990343578 20 Left 990343574 5:54849300-54849322 CCCTTGTATCAACACTTTGCATG No data
Right 990343578 5:54849343-54849365 GGAGGCATTAAGTGCATCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990343578 Original CRISPR GGAGGCATTAAGTGCATCCT AGG Intergenic
No off target data available for this crispr