ID: 990347357

View in Genome Browser
Species Human (GRCh38)
Location 5:54883838-54883860
Sequence GGCCGGTGGAGGAGACCGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990347357_990347375 29 Left 990347357 5:54883838-54883860 CCGAGCGGTCTCCTCCACCGGCC No data
Right 990347375 5:54883890-54883912 TCAAAGTCGGGGTCGCGGCGGGG No data
990347357_990347373 27 Left 990347357 5:54883838-54883860 CCGAGCGGTCTCCTCCACCGGCC No data
Right 990347373 5:54883888-54883910 AGTCAAAGTCGGGGTCGCGGCGG No data
990347357_990347370 18 Left 990347357 5:54883838-54883860 CCGAGCGGTCTCCTCCACCGGCC No data
Right 990347370 5:54883879-54883901 CTGCCTGCGAGTCAAAGTCGGGG No data
990347357_990347367 16 Left 990347357 5:54883838-54883860 CCGAGCGGTCTCCTCCACCGGCC No data
Right 990347367 5:54883877-54883899 CCCTGCCTGCGAGTCAAAGTCGG No data
990347357_990347374 28 Left 990347357 5:54883838-54883860 CCGAGCGGTCTCCTCCACCGGCC No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347357_990347369 17 Left 990347357 5:54883838-54883860 CCGAGCGGTCTCCTCCACCGGCC No data
Right 990347369 5:54883878-54883900 CCTGCCTGCGAGTCAAAGTCGGG No data
990347357_990347372 24 Left 990347357 5:54883838-54883860 CCGAGCGGTCTCCTCCACCGGCC No data
Right 990347372 5:54883885-54883907 GCGAGTCAAAGTCGGGGTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990347357 Original CRISPR GGCCGGTGGAGGAGACCGCT CGG (reversed) Intergenic