ID: 990347359

View in Genome Browser
Species Human (GRCh38)
Location 5:54883849-54883871
Sequence CTGAGCCGGGCGGCCGGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990347359_990347376 27 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347359_990347369 6 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347369 5:54883878-54883900 CCTGCCTGCGAGTCAAAGTCGGG No data
990347359_990347370 7 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347370 5:54883879-54883901 CTGCCTGCGAGTCAAAGTCGGGG No data
990347359_990347373 16 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347373 5:54883888-54883910 AGTCAAAGTCGGGGTCGCGGCGG No data
990347359_990347367 5 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347367 5:54883877-54883899 CCCTGCCTGCGAGTCAAAGTCGG No data
990347359_990347372 13 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347372 5:54883885-54883907 GCGAGTCAAAGTCGGGGTCGCGG No data
990347359_990347374 17 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347359_990347375 18 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347375 5:54883890-54883912 TCAAAGTCGGGGTCGCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990347359 Original CRISPR CTGAGCCGGGCGGCCGGTGG AGG (reversed) Intergenic