ID: 990347362

View in Genome Browser
Species Human (GRCh38)
Location 5:54883855-54883877
Sequence GCATTCCTGAGCCGGGCGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990347362_990347374 11 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347362_990347373 10 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347373 5:54883888-54883910 AGTCAAAGTCGGGGTCGCGGCGG No data
990347362_990347376 21 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347362_990347369 0 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347369 5:54883878-54883900 CCTGCCTGCGAGTCAAAGTCGGG No data
990347362_990347375 12 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347375 5:54883890-54883912 TCAAAGTCGGGGTCGCGGCGGGG No data
990347362_990347370 1 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347370 5:54883879-54883901 CTGCCTGCGAGTCAAAGTCGGGG No data
990347362_990347372 7 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347372 5:54883885-54883907 GCGAGTCAAAGTCGGGGTCGCGG No data
990347362_990347367 -1 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347367 5:54883877-54883899 CCCTGCCTGCGAGTCAAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990347362 Original CRISPR GCATTCCTGAGCCGGGCGGC CGG (reversed) Intergenic
No off target data available for this crispr