ID: 990347365

View in Genome Browser
Species Human (GRCh38)
Location 5:54883863-54883885
Sequence CAGGCAGGGCATTCCTGAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990347365_990347378 29 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347378 5:54883915-54883937 AACCTGGCCCAGCATTGCCTGGG No data
990347365_990347375 4 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347375 5:54883890-54883912 TCAAAGTCGGGGTCGCGGCGGGG No data
990347365_990347374 3 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347365_990347377 28 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347377 5:54883914-54883936 GAACCTGGCCCAGCATTGCCTGG No data
990347365_990347367 -9 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347367 5:54883877-54883899 CCCTGCCTGCGAGTCAAAGTCGG No data
990347365_990347376 13 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347365_990347370 -7 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347370 5:54883879-54883901 CTGCCTGCGAGTCAAAGTCGGGG No data
990347365_990347369 -8 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347369 5:54883878-54883900 CCTGCCTGCGAGTCAAAGTCGGG No data
990347365_990347373 2 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347373 5:54883888-54883910 AGTCAAAGTCGGGGTCGCGGCGG No data
990347365_990347372 -1 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347372 5:54883885-54883907 GCGAGTCAAAGTCGGGGTCGCGG No data
990347365_990347379 30 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347379 5:54883916-54883938 ACCTGGCCCAGCATTGCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990347365 Original CRISPR CAGGCAGGGCATTCCTGAGC CGG (reversed) Intergenic