ID: 990347374

View in Genome Browser
Species Human (GRCh38)
Location 5:54883889-54883911
Sequence GTCAAAGTCGGGGTCGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990347359_990347374 17 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347357_990347374 28 Left 990347357 5:54883838-54883860 CCGAGCGGTCTCCTCCACCGGCC No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347365_990347374 3 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347361_990347374 14 Left 990347361 5:54883852-54883874 CCACCGGCCGCCCGGCTCAGGAA No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347362_990347374 11 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347363_990347374 7 Left 990347363 5:54883859-54883881 CCGCCCGGCTCAGGAATGCCCTG No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data
990347364_990347374 4 Left 990347364 5:54883862-54883884 CCCGGCTCAGGAATGCCCTGCCT No data
Right 990347374 5:54883889-54883911 GTCAAAGTCGGGGTCGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990347374 Original CRISPR GTCAAAGTCGGGGTCGCGGC GGG Intergenic