ID: 990347376

View in Genome Browser
Species Human (GRCh38)
Location 5:54883899-54883921
Sequence GGGTCGCGGCGGGGCGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990347371_990347376 -6 Left 990347371 5:54883882-54883904 CCTGCGAGTCAAAGTCGGGGTCG No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347365_990347376 13 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347362_990347376 21 Left 990347362 5:54883855-54883877 CCGGCCGCCCGGCTCAGGAATGC No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347359_990347376 27 Left 990347359 5:54883849-54883871 CCTCCACCGGCCGCCCGGCTCAG No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347364_990347376 14 Left 990347364 5:54883862-54883884 CCCGGCTCAGGAATGCCCTGCCT No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347366_990347376 -1 Left 990347366 5:54883877-54883899 CCCTGCCTGCGAGTCAAAGTCGG No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347368_990347376 -2 Left 990347368 5:54883878-54883900 CCTGCCTGCGAGTCAAAGTCGGG No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347363_990347376 17 Left 990347363 5:54883859-54883881 CCGCCCGGCTCAGGAATGCCCTG No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data
990347361_990347376 24 Left 990347361 5:54883852-54883874 CCACCGGCCGCCCGGCTCAGGAA No data
Right 990347376 5:54883899-54883921 GGGTCGCGGCGGGGCGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990347376 Original CRISPR GGGTCGCGGCGGGGCGAACC TGG Intergenic