ID: 990347377

View in Genome Browser
Species Human (GRCh38)
Location 5:54883914-54883936
Sequence GAACCTGGCCCAGCATTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990347365_990347377 28 Left 990347365 5:54883863-54883885 CCGGCTCAGGAATGCCCTGCCTG No data
Right 990347377 5:54883914-54883936 GAACCTGGCCCAGCATTGCCTGG No data
990347366_990347377 14 Left 990347366 5:54883877-54883899 CCCTGCCTGCGAGTCAAAGTCGG No data
Right 990347377 5:54883914-54883936 GAACCTGGCCCAGCATTGCCTGG No data
990347368_990347377 13 Left 990347368 5:54883878-54883900 CCTGCCTGCGAGTCAAAGTCGGG No data
Right 990347377 5:54883914-54883936 GAACCTGGCCCAGCATTGCCTGG No data
990347364_990347377 29 Left 990347364 5:54883862-54883884 CCCGGCTCAGGAATGCCCTGCCT No data
Right 990347377 5:54883914-54883936 GAACCTGGCCCAGCATTGCCTGG No data
990347371_990347377 9 Left 990347371 5:54883882-54883904 CCTGCGAGTCAAAGTCGGGGTCG No data
Right 990347377 5:54883914-54883936 GAACCTGGCCCAGCATTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990347377 Original CRISPR GAACCTGGCCCAGCATTGCC TGG Intergenic