ID: 990347446

View in Genome Browser
Species Human (GRCh38)
Location 5:54884123-54884145
Sequence CGGGGCCGCCGCGGCGGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990347446_990347454 1 Left 990347446 5:54884123-54884145 CCCATCCCGCCGCGGCGGCCCCG No data
Right 990347454 5:54884147-54884169 GTCCCGCGCTCACTCCCCAGCGG No data
990347446_990347457 4 Left 990347446 5:54884123-54884145 CCCATCCCGCCGCGGCGGCCCCG No data
Right 990347457 5:54884150-54884172 CCGCGCTCACTCCCCAGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990347446 Original CRISPR CGGGGCCGCCGCGGCGGGAT GGG (reversed) Intergenic
No off target data available for this crispr