ID: 990350595

View in Genome Browser
Species Human (GRCh38)
Location 5:54911738-54911760
Sequence GAGCCCTGGACTTCAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990350595_990350602 18 Left 990350595 5:54911738-54911760 CCTGTCTCTGAAGTCCAGGGCTC No data
Right 990350602 5:54911779-54911801 AAGTACCCGGCACAAAGAAGAGG No data
990350595_990350597 -6 Left 990350595 5:54911738-54911760 CCTGTCTCTGAAGTCCAGGGCTC No data
Right 990350597 5:54911755-54911777 GGGCTCTGCCTCCAGCTCCTAGG No data
990350595_990350600 5 Left 990350595 5:54911738-54911760 CCTGTCTCTGAAGTCCAGGGCTC No data
Right 990350600 5:54911766-54911788 CCAGCTCCTAGGAAAGTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990350595 Original CRISPR GAGCCCTGGACTTCAGAGAC AGG (reversed) Intergenic
No off target data available for this crispr