ID: 990350935

View in Genome Browser
Species Human (GRCh38)
Location 5:54915375-54915397
Sequence GTTTATATGCAGAAGGTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990350935_990350937 2 Left 990350935 5:54915375-54915397 CCTTTAACCTTCTGCATATAAAC No data
Right 990350937 5:54915400-54915422 ATGCCATTAGAATGTTGTGTTGG No data
990350935_990350940 30 Left 990350935 5:54915375-54915397 CCTTTAACCTTCTGCATATAAAC No data
Right 990350940 5:54915428-54915450 GGCATAACTACTCACCACACTGG No data
990350935_990350939 9 Left 990350935 5:54915375-54915397 CCTTTAACCTTCTGCATATAAAC No data
Right 990350939 5:54915407-54915429 TAGAATGTTGTGTTGGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990350935 Original CRISPR GTTTATATGCAGAAGGTTAA AGG (reversed) Intergenic
No off target data available for this crispr