ID: 990353105

View in Genome Browser
Species Human (GRCh38)
Location 5:54938672-54938694
Sequence CTGGACATGGGGGCCTTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990353105_990353114 14 Left 990353105 5:54938672-54938694 CCTACAAAGGCCCCCATGTCCAG No data
Right 990353114 5:54938709-54938731 GTAGCCACTCCACAAACCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990353105 Original CRISPR CTGGACATGGGGGCCTTTGT AGG (reversed) Intergenic
No off target data available for this crispr