ID: 990354947

View in Genome Browser
Species Human (GRCh38)
Location 5:54957814-54957836
Sequence GAGACCTACTAGAAGTGTGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990354947_990354952 22 Left 990354947 5:54957814-54957836 CCACCACACTTCTAGTAGGTCTC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 990354952 5:54957859-54957881 AGACACCCCCAACTAATCCTCGG 0: 1
1: 0
2: 0
3: 5
4: 78
990354947_990354950 -8 Left 990354947 5:54957814-54957836 CCACCACACTTCTAGTAGGTCTC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 990354950 5:54957829-54957851 TAGGTCTCATTTGGTAGACTTGG 0: 1
1: 0
2: 2
3: 8
4: 137
990354947_990354951 -7 Left 990354947 5:54957814-54957836 CCACCACACTTCTAGTAGGTCTC 0: 1
1: 0
2: 1
3: 7
4: 99
Right 990354951 5:54957830-54957852 AGGTCTCATTTGGTAGACTTGGG 0: 1
1: 0
2: 2
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990354947 Original CRISPR GAGACCTACTAGAAGTGTGG TGG (reversed) Exonic
904240190 1:29139226-29139248 TAGACCTACTAGAAGTGTGTAGG - Intergenic
906745261 1:48216939-48216961 GTGAACTGCTGGAAGTGTGGAGG - Intergenic
909543419 1:76816479-76816501 GAGAGCTACTCAAAGTCTGGTGG - Intergenic
912648040 1:111413894-111413916 GAGACCTAGCAGAAGTGTGAAGG + Intergenic
913357071 1:117933541-117933563 GAGAGGTAGTAGAAGTGGGGGGG + Intronic
918312167 1:183292730-183292752 GAGACTTACTGGGAGTGGGGTGG - Intronic
918885250 1:190184725-190184747 GAGTACTACTAGAAGTGGGAAGG + Intronic
1063147419 10:3308792-3308814 GAGAACTACAAGCAGGGTGGGGG - Intergenic
1066152838 10:32642268-32642290 GAGACCTCCTTGAGCTGTGGTGG + Intronic
1068945327 10:62723777-62723799 GTGGCCCAGTAGAAGTGTGGTGG + Intergenic
1069330260 10:67283500-67283522 GTGACCTACTAGGACTTTGGAGG - Intronic
1071065615 10:81631721-81631743 GAGAAGTAATAGAAGTGAGGTGG + Intergenic
1071971478 10:90912068-90912090 AAGTCCTTCTATAAGTGTGGTGG - Intergenic
1079378080 11:19911909-19911931 GAAACCTACTAGAATTTAGGTGG - Intronic
1083428830 11:62603111-62603133 GAAACCTGCTGGAAGGGTGGGGG - Intronic
1083775361 11:64891934-64891956 GAGACTAAGAAGAAGTGTGGGGG + Intergenic
1087142442 11:94778241-94778263 AAGAATTAATAGAAGTGTGGGGG + Intronic
1090509908 11:127363669-127363691 CAGACCTCCTTGAACTGTGGTGG - Intergenic
1094332855 12:29315185-29315207 GAGACCTGAAAGAAGTGAGGGGG + Intronic
1094704437 12:32900315-32900337 GAGACCTGAAAGAAGTGAGGTGG - Intergenic
1095107555 12:38253470-38253492 GGGAACTACTAGAAGAGGGGAGG - Intergenic
1095718016 12:45369990-45370012 GAAACCAACTAGAATTTTGGGGG - Intronic
1096421968 12:51466387-51466409 GAAACCTGTTTGAAGTGTGGGGG - Intronic
1102428369 12:112862313-112862335 GAGAACTACTTGAAGTCAGGAGG + Intronic
1105521187 13:21132135-21132157 GAGAATCACTTGAAGTGTGGAGG + Intergenic
1106007436 13:25783994-25784016 GAGAAATACTAGCAGTCTGGAGG + Intronic
1107466381 13:40654409-40654431 GAGAACTACTTGAACTCTGGAGG + Intronic
1110330209 13:74263544-74263566 GTAACTCACTAGAAGTGTGGAGG - Intergenic
1110390442 13:74967501-74967523 CAGAGCTACTTCAAGTGTGGAGG - Intergenic
1115380741 14:32736020-32736042 GAGACATATAAGAAATGTGGAGG - Intronic
1120620434 14:86756672-86756694 GAGAACCACTTGAACTGTGGAGG + Intergenic
1124944774 15:34254339-34254361 GACACGTACGGGAAGTGTGGAGG + Exonic
1127676810 15:61247138-61247160 TAGACCTACTAGAAGTTTACTGG - Intergenic
1130844429 15:87731467-87731489 AAAACCTAAAAGAAGTGTGGTGG - Intergenic
1135618921 16:23936343-23936365 GAGATCTTCTAGACGTGGGGTGG - Intronic
1143118999 17:4595788-4595810 GAGACCTAGTAGCAGGCTGGAGG - Intronic
1143979980 17:10860584-10860606 GAGAACCACTAATAGTGTGGTGG + Intergenic
1147783828 17:42963731-42963753 GAGACCTAAACGAAGTGAGGGGG - Intronic
1151289881 17:73142052-73142074 GAGAATTACTTGAAGTGGGGAGG - Intergenic
1153635685 18:7110892-7110914 GAGAACAATTAGAAGTGGGGGGG - Intronic
1157155939 18:45266128-45266150 GAGACCTACAGGAAGGATGGAGG + Intronic
1157880047 18:51312906-51312928 GAGAGCTATGAGAAGAGTGGAGG - Intergenic
1166164264 19:40976064-40976086 GAGAATTACTTGAAGTGGGGAGG + Intergenic
925500880 2:4503412-4503434 GAGTCCCACTGGAAGTGTGGTGG + Intergenic
927573408 2:24180141-24180163 GATATCTACTAGATATGTGGGGG - Intronic
927596415 2:24401846-24401868 GGGGCCTGCTAGAAGGGTGGAGG - Intergenic
929660272 2:43777375-43777397 GAGACTTACAACAAGTGGGGAGG - Intronic
930463560 2:51715018-51715040 GAGAACTACTTGAACTGGGGAGG - Intergenic
938438847 2:131307235-131307257 GAGACCTGCAAGAAGTGAGAGGG + Intronic
938550935 2:132381864-132381886 AAGATCTTCTTGAAGTGTGGTGG + Intergenic
943972461 2:194428320-194428342 GAGACTTACTGGAGGGGTGGAGG - Intergenic
1169087790 20:2838207-2838229 GAGCCCTACCATAAGTGGGGGGG - Intronic
1170261200 20:14410386-14410408 GGGGCCTACTAGAAGTGGGAGGG - Intronic
1170634110 20:18090169-18090191 GAGACCCACCAATAGTGTGGTGG + Intergenic
1170901606 20:20468790-20468812 GGGACCTGCTAGATTTGTGGGGG - Intronic
1170999407 20:21397314-21397336 GAGACCTACAAGAAGTTCAGCGG - Exonic
1172099535 20:32476870-32476892 GAGGCCTGCGAGAAGTGAGGAGG + Intronic
1174507347 20:51024980-51025002 GAGACCAACCAGCAGTGTGGGGG + Intergenic
1175043480 20:56078784-56078806 GATACCTACCAGAAGTGCAGAGG - Intergenic
1175461784 20:59157318-59157340 AAGTCCTACTGAAAGTGTGGGGG + Intergenic
1175507053 20:59493562-59493584 GAGACCTCCTGGAGGGGTGGCGG - Intergenic
1179972299 21:44842872-44842894 GAGACCCACTAGCCTTGTGGGGG + Intergenic
1181994064 22:26860948-26860970 GAGAACTACTTGAACTCTGGAGG - Intergenic
951244597 3:20325823-20325845 GAGACCTTTAAGAAGTGTGTAGG - Intergenic
954718095 3:52536897-52536919 GAGACCTTCTGTAAGTGAGGGGG + Exonic
955380023 3:58430839-58430861 AAGACCTACTACATGTCTGGTGG - Exonic
956450606 3:69371141-69371163 GAGACCTACAGGAAGTGATGGGG + Intronic
964795783 3:160495700-160495722 GGGGCTTACTAGATGTGTGGCGG + Exonic
965599302 3:170439988-170440010 GAGAGCTTCTAGAGGTGTGAGGG + Intronic
968033327 3:195522852-195522874 GAAACCTACTTGAAGTGTTGTGG - Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
983963840 4:173786416-173786438 CAGACCTACTTGAGCTGTGGTGG - Intergenic
984339988 4:178444894-178444916 GGGAACTACTAGAAGTGGGAGGG + Intergenic
984749650 4:183259483-183259505 GACACCGGCAAGAAGTGTGGGGG - Intronic
990354947 5:54957814-54957836 GAGACCTACTAGAAGTGTGGTGG - Exonic
990959907 5:61383623-61383645 GAGAACTACTTGAACTGGGGAGG - Intronic
995930189 5:117432331-117432353 GAGACTTACTTGAACTCTGGGGG - Intergenic
997847712 5:137303289-137303311 GAGACCTATAAGATGTGGGGAGG + Intronic
998132299 5:139657561-139657583 GAGACCTACTGGCCCTGTGGAGG + Intronic
1002652065 5:180705785-180705807 GAGGACTACTAGAAGGGGGGAGG - Intergenic
1004975119 6:20957103-20957125 GAGATATACTAGACGTGTGGAGG + Intronic
1008017638 6:46540018-46540040 GAGACCTACCAGATGTGGGAGGG - Intergenic
1008633932 6:53390668-53390690 GACACAAACCAGAAGTGTGGGGG - Intergenic
1008869523 6:56255921-56255943 CAGACCTCCTAGAATTGTTGTGG - Intronic
1009313187 6:62183039-62183061 GATAAATACTAGAAGTGTGTGGG - Intronic
1011049171 6:83125162-83125184 GAAGCCTACTAGAAGTATGAGGG + Exonic
1011868868 6:91867266-91867288 GAGTCTTAGTAGAAGTGTTGAGG - Intergenic
1011970222 6:93213032-93213054 GAGAACAACAAGAAGGGTGGAGG + Intergenic
1015470574 6:133601166-133601188 GAGACTTGCTTGAACTGTGGAGG - Intergenic
1019294261 7:265694-265716 GAGGCCGACGAGAAGCGTGGGGG + Intergenic
1020899209 7:13983099-13983121 AACTCCTACTCGAAGTGTGGAGG + Intronic
1031324544 7:120377344-120377366 GCAAACTACTAGAAGTGTAGTGG + Intronic
1034346292 7:150387357-150387379 GGGAGCTGATAGAAGTGTGGGGG + Intronic
1034990271 7:155543539-155543561 GAGACCTTCTAGAAGTTTCCAGG + Intergenic
1045186269 8:99841699-99841721 GTGGCCTACTGGATGTGTGGAGG - Intronic
1045259601 8:100560412-100560434 AAGACTAACTAAAAGTGTGGTGG + Intergenic
1048471435 8:134707553-134707575 GAGCCCTACAAGAAGTCTTGGGG + Intronic
1060666252 9:125433685-125433707 GTGACCTCCCAGAGGTGTGGCGG - Intergenic
1186660912 X:11666216-11666238 GAGACCTACTAAGAAAGTGGAGG + Intergenic
1189118232 X:38365890-38365912 GAGACCTCCTGGAGGGGTGGGGG + Intronic
1189266325 X:39719564-39719586 GTGACCAACTAGAAGGGTGGTGG + Intergenic
1191109620 X:56794452-56794474 GAGACCTGCTATAGGTGAGGTGG - Intergenic
1191993529 X:67065610-67065632 CAGACCTCCTTGAACTGTGGTGG + Intergenic
1192797926 X:74439900-74439922 GAGGCCAACTAGAATTTTGGTGG + Intronic
1194720612 X:97336163-97336185 GAGACTTAATAGACTTGTGGGGG - Intronic
1199828780 X:151528127-151528149 GAGACCTGCAAGAAGTGAGGTGG + Intergenic
1201494260 Y:14576207-14576229 CAGGCCTTCTTGAAGTGTGGTGG + Intronic
1201896853 Y:19000874-19000896 CAGACCTACTATAAGTGTACAGG + Intergenic