ID: 990355889

View in Genome Browser
Species Human (GRCh38)
Location 5:54965813-54965835
Sequence CCATGGCAACCACTGTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990355889_990355899 29 Left 990355889 5:54965813-54965835 CCATAACACAGTGGTTGCCATGG No data
Right 990355899 5:54965865-54965887 AGTTTCCACCTTCGAAGGGCAGG No data
990355889_990355895 -2 Left 990355889 5:54965813-54965835 CCATAACACAGTGGTTGCCATGG No data
Right 990355895 5:54965834-54965856 GGCTTGTAAGAGGATGAGAGGGG No data
990355889_990355898 25 Left 990355889 5:54965813-54965835 CCATAACACAGTGGTTGCCATGG No data
Right 990355898 5:54965861-54965883 TCGAAGTTTCCACCTTCGAAGGG No data
990355889_990355894 -3 Left 990355889 5:54965813-54965835 CCATAACACAGTGGTTGCCATGG No data
Right 990355894 5:54965833-54965855 TGGCTTGTAAGAGGATGAGAGGG No data
990355889_990355897 24 Left 990355889 5:54965813-54965835 CCATAACACAGTGGTTGCCATGG No data
Right 990355897 5:54965860-54965882 CTCGAAGTTTCCACCTTCGAAGG No data
990355889_990355893 -4 Left 990355889 5:54965813-54965835 CCATAACACAGTGGTTGCCATGG No data
Right 990355893 5:54965832-54965854 ATGGCTTGTAAGAGGATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990355889 Original CRISPR CCATGGCAACCACTGTGTTA TGG (reversed) Intergenic
No off target data available for this crispr