ID: 990358227

View in Genome Browser
Species Human (GRCh38)
Location 5:54991675-54991697
Sequence TTCCCAGGACACTCTCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 177}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990358227_990358235 23 Left 990358227 5:54991675-54991697 CCTGCATGAGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 177
Right 990358235 5:54991721-54991743 GGGATTCCAATCTGATGGGTTGG 0: 1
1: 0
2: 1
3: 9
4: 87
990358227_990358229 2 Left 990358227 5:54991675-54991697 CCTGCATGAGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 177
Right 990358229 5:54991700-54991722 TTGTCAGAAATGCCACAGCCAGG No data
990358227_990358232 18 Left 990358227 5:54991675-54991697 CCTGCATGAGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 177
Right 990358232 5:54991716-54991738 AGCCAGGGATTCCAATCTGATGG No data
990358227_990358233 19 Left 990358227 5:54991675-54991697 CCTGCATGAGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 177
Right 990358233 5:54991717-54991739 GCCAGGGATTCCAATCTGATGGG No data
990358227_990358236 24 Left 990358227 5:54991675-54991697 CCTGCATGAGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 177
Right 990358236 5:54991722-54991744 GGATTCCAATCTGATGGGTTGGG 0: 1
1: 0
2: 0
3: 7
4: 124
990358227_990358239 29 Left 990358227 5:54991675-54991697 CCTGCATGAGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 177
Right 990358239 5:54991727-54991749 CCAATCTGATGGGTTGGGGTAGG 0: 1
1: 0
2: 0
3: 13
4: 221
990358227_990358230 3 Left 990358227 5:54991675-54991697 CCTGCATGAGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 177
Right 990358230 5:54991701-54991723 TGTCAGAAATGCCACAGCCAGGG 0: 1
1: 0
2: 1
3: 26
4: 225
990358227_990358237 25 Left 990358227 5:54991675-54991697 CCTGCATGAGAGTGTCCTGGGAA 0: 1
1: 0
2: 1
3: 24
4: 177
Right 990358237 5:54991723-54991745 GATTCCAATCTGATGGGTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990358227 Original CRISPR TTCCCAGGACACTCTCATGC AGG (reversed) Intronic
901127374 1:6939040-6939062 TTCCCAAGCCACATTCATGCTGG - Intronic
902040809 1:13490946-13490968 CTCCCATGACACTGTCAAGCAGG + Intronic
907230099 1:52989600-52989622 TTACCAGGACACTGTCAGACAGG - Intronic
911250233 1:95568262-95568284 CTCCTATGAGACTCTCATGCCGG + Intergenic
912529787 1:110312021-110312043 TTCCCAGCTCTCTCTCATCCTGG - Intergenic
913684644 1:121220282-121220304 TTCCCAGGCCACTCACTTGTTGG + Intronic
914036480 1:144007898-144007920 TTCCCAGGCCACTCACTTGTTGG + Intergenic
914152974 1:145060048-145060070 TTCCCAGGCCACTCACTTGTTGG - Intronic
916025158 1:160827290-160827312 TTCCCTGAACACTCTCAGACAGG + Intronic
920471955 1:206238832-206238854 TTCCCAGGCCACTCACTTGTTGG + Intronic
923790640 1:237108217-237108239 TTCCCAGGCCCCTCTCCTGGAGG - Intronic
924212590 1:241786169-241786191 TCCCCAGGACACTGTCAAGTGGG + Intronic
1062952407 10:1514743-1514765 ATCCCAGGACACTCAAATGTGGG + Intronic
1066146973 10:32570367-32570389 TTTCCAGGCCAGTCTCATGTTGG + Intronic
1068046459 10:51892488-51892510 TGCCCAGGACACTCCTATGATGG - Intronic
1068779264 10:60902041-60902063 TTCCAAGGACAATTTCATCCTGG + Intronic
1069782841 10:70967721-70967743 TCCCCAGGGCAACCTCATGCAGG + Intergenic
1071038714 10:81280640-81280662 CTCCCAGGACTTTCTCAGGCTGG - Intergenic
1071784872 10:88887840-88887862 TTCTCAGGAGATTCTGATGCAGG + Intronic
1071837619 10:89434911-89434933 TCCCTAGGAGACTCTGATGCAGG + Intronic
1072699203 10:97627917-97627939 ACCCCAGCACACTCTGATGCTGG - Intronic
1074107881 10:110401951-110401973 TTCCCAGATCTCCCTCATGCTGG - Intergenic
1075405083 10:122189601-122189623 TTCCCAGATCACTTTCATGTTGG + Intronic
1076521907 10:131086548-131086570 TGCCCAGGACATTCTCCTGTGGG - Intergenic
1076739553 10:132476578-132476600 TTCCCAGGACACAGTCCAGCTGG - Intergenic
1080660077 11:34288702-34288724 TTCCAAGGTCACTCTCCTGCAGG + Intronic
1081247082 11:40780830-40780852 TTGCCAGGAGAATCTTATGCAGG + Intronic
1081533776 11:43982915-43982937 TGCCCAGGTCACTCTGAGGCTGG + Intergenic
1084196576 11:67526102-67526124 TTCCCTGGCCACTGTCATTCTGG - Intergenic
1084425522 11:69081893-69081915 TTTCCAGGATCCTCTAATGCGGG + Intronic
1084693396 11:70739792-70739814 TTACAAAGACACTGTCATGCTGG - Intronic
1088827057 11:113504787-113504809 TTACCAGGACACTCTTGTGATGG - Intergenic
1090309397 11:125721419-125721441 CTCCCAGGACTCTCTAATGCTGG - Intergenic
1090849848 11:130562420-130562442 CTCCCACGACACTTTCAGGCAGG + Intergenic
1093320945 12:17714244-17714266 TTCCAAGGACACTCTGAGGCCGG - Intergenic
1093702403 12:22236672-22236694 TTCTCATGGCACTTTCATGCAGG - Intronic
1095257171 12:40052231-40052253 TTCCCAGCACACCATCAAGCAGG - Intronic
1096996723 12:55842774-55842796 TCCCCATGACAGTCTCAGGCCGG - Exonic
1098990499 12:77060221-77060243 TTCACAGGACACTCTAATGGAGG - Intronic
1099884309 12:88508513-88508535 TTCCAAGGAGACTCTAATGATGG + Intronic
1100688129 12:97009164-97009186 TTCCCAGGGTTCTTTCATGCTGG - Intergenic
1101434423 12:104652823-104652845 TGCTCAGGACAGTCTCATCCTGG + Intronic
1101625404 12:106435653-106435675 TTCTCAGGACAATCTTAGGCAGG - Intronic
1102187236 12:110958346-110958368 CTCCTAGGACACTATCTTGCCGG + Intergenic
1103213561 12:119184383-119184405 TTCCCAGGACACCAGCATGCAGG + Intronic
1104182427 12:126395496-126395518 TTCCCACCACAATCTCATACTGG - Intergenic
1104763215 12:131310659-131310681 TTCACAGGACACCTTCGTGCTGG - Intergenic
1104816282 12:131647411-131647433 TTCACAGGACACCTTCGTGCTGG + Intergenic
1105718523 13:23091385-23091407 TTCCCAAGAGACACTCAGGCAGG + Intergenic
1105800320 13:23897172-23897194 TTCCAAGGACAATGTCATCCTGG - Intronic
1105848697 13:24315793-24315815 TTCCAAGGACAGTGTCATTCTGG + Intronic
1105889544 13:24672683-24672705 TTCCCAGGCTATACTCATGCTGG + Intergenic
1108161178 13:47641539-47641561 TTCCTAGAACAGTCTCATGGTGG - Intergenic
1109326311 13:60871329-60871351 TTCCCAGGCCATGCTGATGCTGG + Intergenic
1110056644 13:70982548-70982570 TTCCCTGGAAACTCTGAGGCTGG - Intergenic
1110574511 13:77040285-77040307 TTGACAGTACACTCTCATGAGGG - Intergenic
1110806868 13:79765094-79765116 TTCCCAGGAAACTTTGATGAGGG - Intergenic
1113625393 13:111792322-111792344 TTCCCAGGTCTCTCTCATAGGGG + Intergenic
1114164410 14:20204671-20204693 TTCCTAGGACTCTATCATGAAGG + Intergenic
1114345548 14:21790660-21790682 TCCCCAGGACAGTCTCATAGAGG + Intergenic
1117954024 14:61109022-61109044 GTCCCAGCACACTCTCATTCTGG + Intergenic
1120646652 14:87082315-87082337 CTCCCAGGTCATTCTAATGCAGG + Intergenic
1120852347 14:89182743-89182765 GAACCAGGACACTCTCATACTGG + Intronic
1122144259 14:99679833-99679855 TTCCCATGTCATTCTGATGCTGG - Exonic
1122893161 14:104742309-104742331 TCCTCAGGACACCCTCATTCGGG + Intronic
1202854464 14_GL000225v1_random:42240-42262 TTGCCAGGACAGTCTCACACAGG - Intergenic
1125073976 15:35591112-35591134 TTCACAGCACACTCTAATGCAGG - Intergenic
1126984216 15:54284435-54284457 CTCCCAGGACACTTTCACACAGG + Intronic
1128535119 15:68484811-68484833 TCCCCAGGAGACTCACATGTCGG + Intergenic
1129155618 15:73715587-73715609 GTGCCAGGACACTGTCATCCAGG - Intergenic
1130697540 15:86145662-86145684 TTTCTGGGACACGCTCATGCAGG - Intronic
1131890227 15:96964610-96964632 TGCCCAGGACACTGCCAGGCAGG - Intergenic
1132598409 16:763409-763431 CTCCCAGGCCAGTCACATGCAGG - Intronic
1135137804 16:19897743-19897765 TTCCCAGAACCCACCCATGCTGG - Intergenic
1135491489 16:22913317-22913339 TTCCCAGGAGCATCTCATTCAGG - Intronic
1135898515 16:26432948-26432970 TTCTTAGGAAACTCTCATGCAGG - Intergenic
1135953864 16:26939531-26939553 CACCCTGGTCACTCTCATGCTGG + Intergenic
1140566499 16:76049030-76049052 TTGCCAGCACACACACATGCAGG - Intergenic
1141949192 16:87329914-87329936 TTCCCAGGACATCCTCAGGTTGG + Exonic
1142764241 17:2056664-2056686 TGCCCAGCACACTCTCCTGCGGG - Exonic
1142897962 17:2994472-2994494 TTCCCTGGATACTCCCAAGCGGG + Intronic
1143383022 17:6508136-6508158 TTTCCAGGACACTCACCTCCTGG - Intronic
1144154705 17:12488105-12488127 TTCCCAGGAGATTCTCATAAAGG - Intergenic
1144482743 17:15640918-15640940 TTCCCACAACACCCTCATGCTGG - Intronic
1144852426 17:18250777-18250799 TTCCCAGGGAACTCTGGTGCAGG - Intronic
1144915945 17:18724114-18724136 TTCCCACAACACCCTCATGCTGG + Intronic
1146418070 17:32655556-32655578 TTCCTAGAACACTCTGGTGCAGG - Intronic
1148929903 17:51120142-51120164 TTCCCAGGACACTCAGTAGCCGG + Intronic
1149552763 17:57552302-57552324 TTCCCAGGACTCTCTCAGGAAGG - Intronic
1150296151 17:64008702-64008724 TTCCCAGGAGACCCTCAAGAGGG + Intronic
1150335247 17:64326228-64326250 TGCACAGGACACTCTGCTGCAGG + Intronic
1151313043 17:73305887-73305909 TTCCCAGGATTATCTGATGCAGG + Intronic
1151719990 17:75849548-75849570 TTCCCAGGACACCTCCCTGCAGG + Intronic
1152992403 18:375333-375355 TGCCTAGGACACTCTCCTGTGGG + Intronic
1153416438 18:4850846-4850868 TTTTCAGGCCATTCTCATGCAGG + Intergenic
1153662699 18:7339626-7339648 TTCCCAGGACATCTACATGCAGG - Intergenic
1155597868 18:27509549-27509571 TTCCCAGGTAAATCTCATGCAGG - Intergenic
1157475255 18:48019956-48019978 TTTTCAGGTCACTCACATGCAGG - Intergenic
1158146773 18:54323120-54323142 TTCCCACTACACCCTGATGCAGG + Intergenic
1162999304 19:14356136-14356158 GTCCCAGGACACACTCGGGCAGG + Intergenic
1163064827 19:14785216-14785238 GTCCCAGGACACACTCGGGCAGG - Intergenic
1164723166 19:30446503-30446525 TTCCCATAATTCTCTCATGCAGG + Intronic
1164934980 19:32203079-32203101 TTCTCTGGTCACTCTCATCCTGG - Intergenic
1165059487 19:33198137-33198159 GCCCCAGGACACCCTCCTGCTGG + Intronic
925088122 2:1128806-1128828 TTCCCTGTGCACTCTCATCCTGG - Intronic
925540224 2:4958811-4958833 TTCCCAGGAGATACTGATGCTGG - Intergenic
925825929 2:7848614-7848636 TACCCAGGAGGCTCTGATGCTGG + Intergenic
926795842 2:16618172-16618194 TTTCGAGCACACTCTCATCCTGG - Intronic
929549438 2:42880138-42880160 GGGGCAGGACACTCTCATGCAGG + Intergenic
930110675 2:47676091-47676113 TTCGCAGGACAGCCTCATCCTGG + Intergenic
934783464 2:96987626-96987648 TTCCAAGGACACTCTAATCATGG + Intronic
942104437 2:172618892-172618914 TTCCCAGTACTCACTGATGCAGG - Intergenic
944359433 2:198835546-198835568 TTCCCAAAACACTCTGATTCAGG + Intergenic
946765998 2:223041630-223041652 TTCCCAGGAGACTTGCATGAAGG + Intergenic
947705055 2:232267922-232267944 TTCCCAAGACACTTTCATAATGG - Intronic
948789964 2:240372114-240372136 TGCCCAGGACCCTCTCAGGCTGG - Intergenic
1172670874 20:36633700-36633722 TTGCAAGGACCCTCTCAGGCTGG + Intronic
1172715545 20:36960588-36960610 TGCCCAGGCCACTCTCACACTGG + Intergenic
1172910469 20:38405427-38405449 TTCCCAGGACAATAACATGAAGG + Intergenic
1174582133 20:51579508-51579530 TTCCCAGGCCCCTCTCCTGAAGG + Intergenic
1175121763 20:56721389-56721411 CTCACAGGGCACTGTCATGCTGG - Intergenic
1181127359 22:20709954-20709976 CTCCCTGGTCACTCTCATGTTGG - Exonic
1182001506 22:26923614-26923636 TTCCCAGGAAACCCACATTCTGG - Intergenic
1182278254 22:29203864-29203886 TTACCAGGAGAGTCTCTTGCTGG + Intergenic
1182700954 22:32237879-32237901 TTCTCATGACACTCTCATAAAGG - Intronic
1183515197 22:38261429-38261451 TTCCCAGGAATCTCTCAACCAGG + Intronic
1185307725 22:50130616-50130638 TTCTCATGGCACTCACATGCTGG - Intronic
1185328550 22:50240141-50240163 ATCCAAGGCCACGCTCATGCAGG + Intronic
953563321 3:44011668-44011690 TTCTCTGGTCACTCTGATGCTGG + Intergenic
954256878 3:49413150-49413172 TTCCAAGGACACTCCTGTGCTGG + Intronic
960314089 3:116155176-116155198 TTCACTGGACTCTCTCATGAGGG + Intronic
961331823 3:126147126-126147148 ATCCCAGGGCCCTCTGATGCTGG + Intronic
965616478 3:170598182-170598204 ATCCCAGGACAGTGTCATGTGGG + Intronic
967256125 3:187593898-187593920 TTCCCAGGCCCCTCTCCTCCTGG + Intergenic
970349118 4:15183384-15183406 TTCCCAGGCCACTCACATGGGGG + Intergenic
970853206 4:20626308-20626330 TTCCTAGGGCAGTCTGATGCAGG + Intergenic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
972296799 4:37746805-37746827 TCCCCAGGAGATTCTCCTGCAGG - Intergenic
975594924 4:76040962-76040984 TTTCCAGGACACTCTAAGGCAGG - Intronic
979622884 4:122815292-122815314 GTCCCCGGACTTTCTCATGCAGG - Intergenic
980886915 4:138772798-138772820 TTCCCAGGACACTTCTATGTTGG - Intergenic
985040719 4:185888971-185888993 TTCCCAGCACACACTCCAGCAGG + Intronic
985788697 5:1913655-1913677 TTCCGGGGCCTCTCTCATGCTGG + Intergenic
988588417 5:32527825-32527847 TTCCCAGGACAATCTGAAGCTGG + Intergenic
989358176 5:40568131-40568153 TTCTCAGGATATTCTCAGGCAGG + Intergenic
990000614 5:50887198-50887220 TTCCCTGGGGACTCTGATGCTGG + Intergenic
990358227 5:54991675-54991697 TTCCCAGGACACTCTCATGCAGG - Intronic
990647716 5:57863363-57863385 TTCACAGGAAACTCTCATATTGG + Intergenic
990984415 5:61627613-61627635 TTCCAAGGTCATTCTCTTGCTGG + Intergenic
991493395 5:67205098-67205120 TACCCAGGGCACTCACATGCAGG - Intergenic
993096249 5:83482238-83482260 TTCCCTGGACATTATCATGCTGG - Intronic
994629980 5:102273349-102273371 ATCCCAGGAAAATCTGATGCAGG + Intronic
995660265 5:114474500-114474522 TTCCCTGCACACTCTCATACAGG - Intronic
996603279 5:125291475-125291497 ACCCCAGGACTCTCTCATGTGGG + Intergenic
1002690159 5:181044895-181044917 ATCCTAGGACACTCTCCTCCAGG - Intronic
1003562665 6:7195772-7195794 TTCCCAGGACACCCACACCCAGG + Intronic
1006445451 6:34077303-34077325 TGCCCAGGCCCCTCTCAGGCTGG + Intronic
1006553707 6:34847243-34847265 TTCCAAGAACACTTTCATGTAGG + Intronic
1009840902 6:69073339-69073361 TTCTCAGGAGACTCCCTTGCTGG - Intronic
1009930927 6:70176785-70176807 TTCCCAAGTCACTTTCATGGAGG + Intronic
1013619888 6:111878033-111878055 TTTCCAGGACCATCTCCTGCTGG - Intergenic
1018008320 6:159644562-159644584 TGCCCAAGACACTCACTTGCAGG + Intergenic
1019062852 6:169269075-169269097 TTCCCATGACATTCTTATTCTGG + Intergenic
1021659737 7:22908014-22908036 TTCCCAGAAGGTTCTCATGCAGG + Intergenic
1022798147 7:33749207-33749229 TCCCCAGGAGACTCTGATGTAGG - Intergenic
1023055177 7:36285097-36285119 TCCCCAGGAGACTCTAATGAGGG - Intronic
1023736676 7:43241863-43241885 TTCCCAGGCCTCTGTCATGGGGG + Intronic
1024333840 7:48183576-48183598 TTCCCAGGAGAGCCTCATTCAGG + Intronic
1024374861 7:48625661-48625683 TTCTCATGCCATTCTCATGCTGG + Intronic
1024667866 7:51564089-51564111 TTCCCAGCACACACTGAAGCTGG - Intergenic
1026009053 7:66622521-66622543 ATCCCAGGATACTATAATGCTGG - Intergenic
1026675501 7:72424921-72424943 TTCACAGGACTCACTCAAGCGGG + Intronic
1028192195 7:87866552-87866574 TTCCCATGAATGTCTCATGCAGG - Intronic
1031631960 7:124053957-124053979 TTCCCATGAGATTCTTATGCTGG - Intergenic
1032509177 7:132458353-132458375 TGCCCTTGATACTCTCATGCAGG - Intronic
1033341850 7:140498326-140498348 CGCTCAGGACACTCTCATCCTGG - Intergenic
1034359335 7:150480389-150480411 TACCAAGGCCACTATCATGCTGG + Intergenic
1036686499 8:10914924-10914946 TTCTCAGGACACTGTCCTCCAGG + Intronic
1037291094 8:17350142-17350164 ATCCCAGGACACTTCCATGTGGG - Intronic
1040671561 8:49697832-49697854 ATACCTGGAGACTCTCATGCAGG + Intergenic
1041167734 8:55106818-55106840 TTCCCAGATGACTCTCATGATGG - Intronic
1041853916 8:62426966-62426988 ATCACAGGACACTCCCATGCTGG + Intronic
1045029011 8:98117416-98117438 TTCCCCCGACACTCGCATCCTGG - Intronic
1045955326 8:107899088-107899110 TTCACAGGCCACTCTCAGTCTGG + Intergenic
1048223643 8:132565236-132565258 TTTGCAGGCCACTCACATGCAGG + Intergenic
1048274630 8:133056986-133057008 TTCCCAGGGGATTCTGATGCAGG + Intronic
1048503882 8:135003392-135003414 TTCCCAGGACACTCCTATGAGGG - Intergenic
1049387780 8:142353071-142353093 CTCCCAGGACACTCTCATTCAGG + Intronic
1057692516 9:97297844-97297866 TTCCCATGCCACCCTCAGGCAGG + Intergenic
1058747755 9:108008331-108008353 TTTCCAGGACCATCTCATGGAGG + Intergenic
1060627134 9:125123883-125123905 TTTCCAGGACACTGTCAAACAGG + Intronic
1060855216 9:126909623-126909645 TTGCTAGGAGACTCTCTTGCTGG - Intergenic
1061243011 9:129385172-129385194 TTCCCAGGACACTCCCTTTTGGG - Intergenic
1061757518 9:132825706-132825728 TTCCCAGCACCTTCTCCTGCTGG - Intronic
1061783584 9:133009792-133009814 TTCCCATGACTCCCTCCTGCAGG - Intergenic
1185630324 X:1512097-1512119 TCCCCAGGACACTCTTACACAGG - Intronic
1185998007 X:4974707-4974729 TTGCCCTGACATTCTCATGCTGG + Intergenic
1187283803 X:17883498-17883520 TTCCCAGGTGATGCTCATGCTGG + Intergenic
1188251240 X:27897567-27897589 TTCCCAGACCACTCTCCTGTAGG - Intergenic
1190989828 X:55535874-55535896 TTCCCAGCACACACACATGCAGG - Intergenic
1194397408 X:93403249-93403271 TTCCCAGGATGTTCTCATGATGG - Intergenic
1199826521 X:151505719-151505741 GTCATAGTACACTCTCATGCAGG + Intergenic
1201677768 Y:16606252-16606274 TTGCCCTGACATTCTCATGCTGG - Intergenic