ID: 990363634

View in Genome Browser
Species Human (GRCh38)
Location 5:55047286-55047308
Sequence AGCCTCCATCAACACCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990363629_990363634 -1 Left 990363629 5:55047264-55047286 CCAAAGTCCAGGTTTCCCACTCA No data
Right 990363634 5:55047286-55047308 AGCCTCCATCAACACCCACAGGG No data
990363627_990363634 10 Left 990363627 5:55047253-55047275 CCAGATGGAAGCCAAAGTCCAGG No data
Right 990363634 5:55047286-55047308 AGCCTCCATCAACACCCACAGGG No data
990363624_990363634 25 Left 990363624 5:55047238-55047260 CCTACCTCATTACTGCCAGATGG No data
Right 990363634 5:55047286-55047308 AGCCTCCATCAACACCCACAGGG No data
990363623_990363634 28 Left 990363623 5:55047235-55047257 CCACCTACCTCATTACTGCCAGA No data
Right 990363634 5:55047286-55047308 AGCCTCCATCAACACCCACAGGG No data
990363630_990363634 -8 Left 990363630 5:55047271-55047293 CCAGGTTTCCCACTCAGCCTCCA No data
Right 990363634 5:55047286-55047308 AGCCTCCATCAACACCCACAGGG No data
990363626_990363634 21 Left 990363626 5:55047242-55047264 CCTCATTACTGCCAGATGGAAGC No data
Right 990363634 5:55047286-55047308 AGCCTCCATCAACACCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990363634 Original CRISPR AGCCTCCATCAACACCCACA GGG Intergenic
No off target data available for this crispr