ID: 990364261

View in Genome Browser
Species Human (GRCh38)
Location 5:55053766-55053788
Sequence CAGCTGTTCTGGGGGATGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990364261_990364271 8 Left 990364261 5:55053766-55053788 CCGACCATCCCCCAGAACAGCTG No data
Right 990364271 5:55053797-55053819 AGAAACTTGCAAAGAGGGAGTGG No data
990364261_990364273 10 Left 990364261 5:55053766-55053788 CCGACCATCCCCCAGAACAGCTG No data
Right 990364273 5:55053799-55053821 AAACTTGCAAAGAGGGAGTGGGG No data
990364261_990364272 9 Left 990364261 5:55053766-55053788 CCGACCATCCCCCAGAACAGCTG No data
Right 990364272 5:55053798-55053820 GAAACTTGCAAAGAGGGAGTGGG No data
990364261_990364274 29 Left 990364261 5:55053766-55053788 CCGACCATCCCCCAGAACAGCTG No data
Right 990364274 5:55053818-55053840 GGGGTCCTGCTCTCACTGAGTGG No data
990364261_990364269 2 Left 990364261 5:55053766-55053788 CCGACCATCCCCCAGAACAGCTG No data
Right 990364269 5:55053791-55053813 TAGGAGAGAAACTTGCAAAGAGG No data
990364261_990364275 30 Left 990364261 5:55053766-55053788 CCGACCATCCCCCAGAACAGCTG No data
Right 990364275 5:55053819-55053841 GGGTCCTGCTCTCACTGAGTGGG No data
990364261_990364270 3 Left 990364261 5:55053766-55053788 CCGACCATCCCCCAGAACAGCTG No data
Right 990364270 5:55053792-55053814 AGGAGAGAAACTTGCAAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990364261 Original CRISPR CAGCTGTTCTGGGGGATGGT CGG (reversed) Intergenic
No off target data available for this crispr