ID: 990365855

View in Genome Browser
Species Human (GRCh38)
Location 5:55069648-55069670
Sequence CTCCCTGGGGATGAAAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990365855_990365864 9 Left 990365855 5:55069648-55069670 CCCACACTTTCATCCCCAGGGAG No data
Right 990365864 5:55069680-55069702 TTCATTGCCTTGCCTTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990365855 Original CRISPR CTCCCTGGGGATGAAAGTGT GGG (reversed) Intergenic
No off target data available for this crispr