ID: 990369755

View in Genome Browser
Species Human (GRCh38)
Location 5:55105327-55105349
Sequence GGTCTACATAGAGTAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990369751_990369755 19 Left 990369751 5:55105285-55105307 CCTAGAGTCCAACAGGAATAGGA 0: 1
1: 0
2: 2
3: 11
4: 160
Right 990369755 5:55105327-55105349 GGTCTACATAGAGTAAAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90
990369749_990369755 20 Left 990369749 5:55105284-55105306 CCCTAGAGTCCAACAGGAATAGG 0: 1
1: 0
2: 1
3: 12
4: 88
Right 990369755 5:55105327-55105349 GGTCTACATAGAGTAAAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90
990369752_990369755 11 Left 990369752 5:55105293-55105315 CCAACAGGAATAGGATTTGCATC 0: 1
1: 0
2: 1
3: 6
4: 130
Right 990369755 5:55105327-55105349 GGTCTACATAGAGTAAAAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990369755 Original CRISPR GGTCTACATAGAGTAAAAGC AGG Intronic
900750144 1:4390532-4390554 GGTCTATAATGAGTAAAAGGAGG + Intergenic
900867841 1:5281182-5281204 AGTCTACTTAGAATATAAGCTGG + Intergenic
904875815 1:33653711-33653733 GGACTGGATAGAGTAAGAGCTGG + Intronic
913469121 1:119172254-119172276 GGGCCAGATAGAATAAAAGCAGG + Intergenic
914673537 1:149890081-149890103 GGTCCACATAGAGTCCAAACAGG + Intronic
918898253 1:190377290-190377312 GGTCTAAAGGGATTAAAAGCAGG - Intronic
919585523 1:199434373-199434395 GGTGTACACAGAATGAAAGCTGG - Intergenic
920927007 1:210351256-210351278 GGTCTAAATAGAACAAAAGGAGG - Intronic
1062922412 10:1290107-1290129 GATCTGTATAGAGCAAAAGCAGG + Intronic
1064664817 10:17639874-17639896 GACCTAAATAGAGTAAGAGCAGG + Intergenic
1067734361 10:48837791-48837813 TGTGTACATAGAGCATAAGCTGG + Intronic
1071231756 10:83596123-83596145 GGCCTACATAGAACAAAAGGTGG + Intergenic
1071987379 10:91065872-91065894 GGTGAGCATAGAGTCAAAGCAGG - Intergenic
1073509108 10:104032150-104032172 GGTCTCCAGAGGGTGAAAGCTGG - Exonic
1076213060 10:128666529-128666551 GGTATACATAAAGTAAAAATTGG + Intergenic
1078479813 11:11665744-11665766 GGTCTTCATATATTAAAAGTGGG + Intergenic
1079566606 11:21890600-21890622 GGTCTACGGAGAGTGAAAACTGG - Intergenic
1080003356 11:27376760-27376782 GGACTACATAGAGTTAAAATGGG + Intronic
1080420021 11:32101371-32101393 AGTCTCAATAAAGTAAAAGCTGG + Intronic
1082773501 11:57227889-57227911 GGTCCACGTAGAGTAAAGCCTGG + Intergenic
1085550345 11:77364221-77364243 GCCCAACATAAAGTAAAAGCTGG + Intronic
1087667435 11:101066910-101066932 AGTCTACAAAAAGTGAAAGCTGG - Intronic
1091221503 11:133932211-133932233 GGTCTGCATAGAGGAAGCGCAGG + Exonic
1093913879 12:24778408-24778430 AGTATACATAGAATAAAAACTGG - Intergenic
1094276988 12:28688943-28688965 GTTGTACATAGTGTAGAAGCTGG + Intergenic
1096772850 12:53947163-53947185 GGAATACAGAGAGTAAAAGTGGG - Intergenic
1099038815 12:77624508-77624530 GGTCTGGAAAGAGTGAAAGCAGG + Intergenic
1099443966 12:82729702-82729724 GGGCCAGATAGAATAAAAGCAGG + Intronic
1100094812 12:91020650-91020672 GGTGTAGAAAGAGTGAAAGCTGG - Intergenic
1101766842 12:107708906-107708928 GGCCTAGAAAGAGTAAAAGATGG - Exonic
1109701821 13:66035679-66035701 AGACTACATAGAATCAAAGCAGG - Intergenic
1110477353 13:75931891-75931913 TGTCTCCATGGAGTAAAAACTGG + Intergenic
1112264499 13:97910893-97910915 GGTCTACATGGACATAAAGCTGG + Intergenic
1112627747 13:101125280-101125302 GGTGTACAAGGAGTTAAAGCAGG + Intronic
1118020108 14:61702786-61702808 TCTCTACATAGTGAAAAAGCAGG - Intronic
1120125931 14:80743424-80743446 GGTCTACAGCAAGTAAAAGCTGG + Intronic
1120614568 14:86687905-86687927 GAACAACATAAAGTAAAAGCAGG - Intergenic
1137689249 16:50409503-50409525 GCTCTTCCTAGAGCAAAAGCAGG - Intergenic
1140142941 16:72276410-72276432 GTTGTACACAGAGGAAAAGCTGG - Intergenic
1141109930 16:81263934-81263956 GGGCTACAGAGAGGAAATGCTGG + Intronic
1144476689 17:15595031-15595053 GGCCTTCTTAGAGCAAAAGCAGG - Intronic
1144921562 17:18768372-18768394 GGCCTTCTTAGAGCAAAAGCAGG + Intronic
1147037523 17:37692854-37692876 GGTCTACATGCAGTCAAAGGAGG - Intronic
1149590556 17:57826747-57826769 GGTCTTCATAGAGGAAAAAATGG + Intergenic
1149765704 17:59276326-59276348 GGTTTACATAAAATATAAGCTGG - Intergenic
1153291821 18:3509290-3509312 GGGCTGCAGAGTGTAAAAGCTGG - Intronic
1155184967 18:23379619-23379641 GGGATACAGAGAGTAAAAACAGG + Intronic
1155443193 18:25883588-25883610 GTACTACATAGAAAAAAAGCAGG - Intergenic
1156989423 18:43389471-43389493 GGTTTTCATCGAGTAAAAGCAGG + Intergenic
1158283792 18:55855951-55855973 GGTCTCCCTAGAGGAGAAGCTGG + Intergenic
1166591866 19:44006656-44006678 TGTATACATAGAGGAAAAGTAGG - Intronic
1168701585 19:58442943-58442965 GGGCCAAATAGAATAAAAGCTGG - Intergenic
926451512 2:13010214-13010236 AGTCCACATAGAATGAAAGCAGG + Intergenic
932444373 2:71766198-71766220 GGTCTGAATAGAATAAAAGGTGG + Intergenic
933087012 2:78066722-78066744 GGTCTACATAGAGAACATTCTGG + Intergenic
935080177 2:99785210-99785232 GGTCCACATAGATTAGAACCTGG - Intronic
936596081 2:113849505-113849527 TATGTACATAGAGTAAAAGCAGG + Intergenic
936644290 2:114350781-114350803 GGTTTACATAGAGGCATAGCAGG - Intergenic
937191832 2:120109522-120109544 GGTTCACCTAGAGTAACAGCAGG - Intronic
938590265 2:132729052-132729074 GGTCCAAATACAGTGAAAGCTGG + Intronic
939040185 2:137179398-137179420 TGTCTACATAGAGGGAAAACTGG - Intronic
939507815 2:143070991-143071013 GGTCTACATAGTGTGGTAGCTGG - Intergenic
940124148 2:150304984-150305006 GTTCTACTTATAGTAATAGCAGG - Intergenic
942862613 2:180634484-180634506 GGTATACATAGAATATAATCAGG - Intergenic
1169988984 20:11478070-11478092 GGCCTAGATAAAATAAAAGCTGG + Intergenic
1170671185 20:18435106-18435128 GCTCGGCATAGAGTAAAAGCTGG + Intronic
1171437968 20:25138342-25138364 GGGCTACATAAAATAAGAGCAGG - Intergenic
1175109201 20:56634611-56634633 GGTACACCTTGAGTAAAAGCTGG + Intronic
1175535629 20:59709070-59709092 GCTCTTCATAGAGTATGAGCAGG + Intronic
1179194298 21:39151193-39151215 GGTCTAGATGGAGTAAAACCTGG - Intergenic
1179649458 21:42797721-42797743 GGACTACTCAGAGCAAAAGCAGG - Intergenic
950767990 3:15288150-15288172 GGTCTGAATAGAGCAAAAGAGGG - Intronic
955636488 3:61035813-61035835 GGACTAACTAGAGTAAAAGCAGG - Intronic
959150759 3:102604753-102604775 GTGCTACATCTAGTAAAAGCTGG + Intergenic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
964918563 3:161867472-161867494 TGTCTACATAAAATTAAAGCTGG + Intergenic
978253516 4:106663253-106663275 GGTCTACATAGAGGAAATGCTGG + Intergenic
990369755 5:55105327-55105349 GGTCTACATAGAGTAAAAGCAGG + Intronic
991538712 5:67703264-67703286 TGTCTGCATAGAGAAAAAGAGGG + Intergenic
995524567 5:113040163-113040185 GTTATACATACAGTAAAGGCGGG + Intronic
998634317 5:143935629-143935651 GGTCTCAATATAGTAATAGCTGG + Intergenic
1001318565 5:170662063-170662085 TGTCTACATTCAGTAAATGCTGG - Intronic
1003557745 6:7155949-7155971 CTTCTACCTAGAGTTAAAGCCGG - Intronic
1004252251 6:14032435-14032457 GCTCTACCTAGAGGAAGAGCAGG + Intergenic
1004502179 6:16218667-16218689 GGGCCAGATAGAATAAAAGCAGG + Intergenic
1010020579 6:71155227-71155249 GTTCTATATTGAGGAAAAGCAGG - Intergenic
1011454571 6:87534362-87534384 TATATACATAGAGTAAAAGTAGG - Intronic
1012652240 6:101769840-101769862 GGTTTTCAAAGAGAAAAAGCAGG + Intronic
1017702294 6:157086829-157086851 GGTTTGCACAGGGTAAAAGCTGG + Intronic
1039726088 8:40218234-40218256 TGTCTACATATAGTGGAAGCTGG - Intergenic
1041357519 8:57015738-57015760 GGTGTTCATAGAGTAATACCAGG - Intergenic
1041562033 8:59228759-59228781 GGCTTACATACAGTAATAGCAGG + Intergenic
1043225870 8:77729342-77729364 GGTTTACATGGAGTAAAGGAGGG + Intergenic
1043331843 8:79126607-79126629 GAACTACATAGAGTGAAAGAAGG - Intergenic
1053371813 9:37567879-37567901 GGACTAAATAGAGTAGAAGCGGG - Intronic
1197425470 X:126291812-126291834 GGCCTACATATAGTCAAAGAGGG - Intergenic
1198338237 X:135689243-135689265 GGCATACATTGAGTAACAGCTGG + Intergenic
1199045355 X:143164103-143164125 GGTCTCCATAGAGACAAAGGTGG - Intergenic
1199656216 X:149997856-149997878 GGTTTACATAAAGAGAAAGCTGG - Intergenic