ID: 990369969

View in Genome Browser
Species Human (GRCh38)
Location 5:55107806-55107828
Sequence AGTGAGCCCCAAGAATGACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990369969 Original CRISPR AGTGAGCCCCAAGAATGACC TGG (reversed) Exonic
900160213 1:1219741-1219763 AGTGAGCCCCAAGATGGGGCAGG - Intronic
900234882 1:1583668-1583690 AGTGTGCCCCACGGATGTCCTGG - Intergenic
901083627 1:6597602-6597624 AGTGAGCACCAAGAAGAACAGGG - Intronic
902066825 1:13695265-13695287 ACTGAGCCCCAAGTCTGAGCTGG - Intergenic
905957147 1:42007266-42007288 AGTGAGCCTCATGAAGGACTGGG - Intronic
908386144 1:63643678-63643700 AGTCTGCCCAAAGAATGGCCGGG - Intronic
912757392 1:112335794-112335816 ACTGAGTCTTAAGAATGACCAGG + Intergenic
916012509 1:160718870-160718892 CTGGAGCCCCAAGAATGAACAGG + Intergenic
918635020 1:186764886-186764908 AGTGACCACCCAGAATGAGCAGG + Intergenic
920228676 1:204455938-204455960 CGGGAGCCGCAAGCATGACCTGG - Exonic
923873376 1:238020401-238020423 AGTAAGCCACAAGAATAATCAGG - Intergenic
1063671752 10:8104827-8104849 AGGGAGCCCTGAGAATCACCAGG + Intergenic
1065928128 10:30454224-30454246 ATTGAACACCAAGACTGACCTGG - Intronic
1067567944 10:47351538-47351560 GGTGAGACCCAAGAGAGACCTGG + Exonic
1068514016 10:58003928-58003950 AGAGAGACCCAAGCATGACTGGG + Intergenic
1077184816 11:1231294-1231316 AGTGAGACCCAGGAGTGGCCAGG - Intronic
1077636286 11:3843368-3843390 TGTGAGCCCCAGAAATGACAGGG + Intergenic
1079366462 11:19814343-19814365 AGTGAGACCCATGGATGTCCCGG + Intronic
1084361010 11:68668460-68668482 AGTCACCTCCAAGAAGGACCTGG - Intergenic
1091433693 12:457472-457494 GGAGAGCCACAAGAATGTCCTGG + Intergenic
1096771108 12:53936626-53936648 AGGGAGCCCCAAGAATGGGGTGG + Intergenic
1096839989 12:54374287-54374309 TCTGAGCCCCAGGAATAACCAGG - Intronic
1100309818 12:93383886-93383908 AGTGACCCCTAAGAATGAAGAGG - Intronic
1101177110 12:102164485-102164507 AGTGAATTCAAAGAATGACCTGG + Exonic
1102491252 12:113290800-113290822 TGTGAGCTCCAGGAAAGACCAGG - Intronic
1103043184 12:117712512-117712534 AGTGAGGCCCAAGAAGGAGCAGG - Intronic
1103605149 12:122080419-122080441 TGTGAGCCCCAAGCATATCCAGG + Intronic
1105429097 13:20320948-20320970 TGTAAGCCCCAAGAATGAAAGGG + Intergenic
1115119790 14:29926820-29926842 AGAGTGCCCCCGGAATGACCTGG - Intronic
1118641328 14:67795097-67795119 AGACAGCCCCTCGAATGACCAGG - Intronic
1118662788 14:68032941-68032963 AATGATCCCCAAGAAGGATCAGG - Intronic
1122739035 14:103860102-103860124 AGTGGGACCCAAGGTTGACCTGG - Intergenic
1124881130 15:33643895-33643917 AGTGAGCCTAAAGAATGACTTGG - Intronic
1125344764 15:38707997-38708019 TGTAACACCCAAGAATGACCAGG + Intergenic
1125938292 15:43656599-43656621 AGTTAGCCCCAGAAATGCCCTGG - Intronic
1125950565 15:43747915-43747937 AGTTAGCCCCAGAAATGCCCTGG - Intronic
1126964276 15:54033568-54033590 AGTGGGCCCCAAGAAGGACCTGG + Intronic
1129456492 15:75678754-75678776 AGAGAGACCCAAGAATGCCTGGG - Intronic
1136040092 16:27571818-27571840 AGTGAGCCCTAAGGCTGGCCAGG - Intronic
1136428722 16:30185196-30185218 TGTGTGCCCCCAGAATGAGCCGG + Exonic
1137382029 16:48008324-48008346 AGTGAACGCCAAGAAGGACATGG - Intergenic
1138944094 16:61826730-61826752 AGTGAGTCCCAAGAGTTACCAGG + Intronic
1139262543 16:65608781-65608803 AGTGAGCCTCAAGAATACCAGGG - Intergenic
1139323007 16:66130477-66130499 AGTGAGCACCAGGCATCACCAGG - Intergenic
1142310416 16:89309174-89309196 AGTGTGCCCCAAGAACCACCAGG - Intronic
1143871504 17:9960062-9960084 AGAGATCCCCAAGCAGGACCTGG + Intronic
1144524947 17:15981417-15981439 AGTGGGCCCCATGAATCACTAGG - Intronic
1148355472 17:46972657-46972679 AGTGAGCCCCAGGAGAAACCCGG + Intronic
1151334257 17:73430750-73430772 AATGAGCCCCAACTATGACGTGG - Intronic
1151425589 17:74029204-74029226 AGGGAGCCCCAACATTGAACGGG - Intergenic
1152844654 17:82592345-82592367 TGTGAGCCCCATGAAGGACCAGG - Intronic
1153020432 18:623876-623898 ATTAAGCCCAAAGAATCACCTGG - Intronic
1153179189 18:2413659-2413681 GGTGAGCCCCAAGACTGCACAGG + Intergenic
1160666740 19:334218-334240 AGAGAGCCCCATGAAAGACCTGG + Intronic
1164698296 19:30263084-30263106 AGTGAGCCCCGAGAAGGAGGTGG + Intronic
1167524202 19:49973419-49973441 GGTGAGGCCCAGGCATGACCGGG - Intergenic
925970645 2:9104492-9104514 TTGGAGCCCCAACAATGACCAGG + Intergenic
926150965 2:10425356-10425378 AGAGAGCCCAAACAATGCCCGGG - Intronic
927742784 2:25587499-25587521 AATGAACACCAAGAATGACCTGG + Intronic
927877425 2:26668064-26668086 AGAGAGCCCCCAGGATGTCCTGG + Intergenic
932622208 2:73271388-73271410 AGTGAGCCCCAGGACTGTTCTGG + Intronic
936463967 2:112730653-112730675 AGTGAGCCCCCAGAAAGCCAAGG - Intronic
938810195 2:134845803-134845825 AACGAGCCCCAAGAGTGAGCTGG + Intronic
943930515 2:193845444-193845466 AGTGATCCCAAAGAATGTACTGG - Intergenic
944102830 2:196046931-196046953 AGTGAGACCCAGGTAAGACCAGG + Intronic
948264969 2:236629378-236629400 AGGGAGCCCCAAGAGAGCCCAGG - Intergenic
948305009 2:236940253-236940275 AGGGAGCCCACAGAAGGACCAGG + Intergenic
1169274017 20:4221180-4221202 AGACAGCCCCAAGCATGGCCAGG - Exonic
1169878192 20:10320208-10320230 AGTGAGACCCAAGCAGGAACTGG - Intergenic
1171429900 20:25076395-25076417 AGTGAGCCCTGAGAATGGCTTGG - Exonic
1172493527 20:35360775-35360797 AGTGAGCGCCAAGAAACACGGGG + Intronic
1174871365 20:54185932-54185954 GCTGAGCCCCTAGAATCACCTGG + Intergenic
1178011002 21:28287118-28287140 AGTGAACCCCAAGGATGTTCAGG - Intergenic
1179876047 21:44268053-44268075 AGTGAACCCCAACTATGGCCCGG - Intergenic
1180018616 21:45104416-45104438 AGTGAGTTCCAAGAAAGAGCAGG + Intronic
951366868 3:21794045-21794067 AGAGAGCACAAAGAATGACCAGG + Intronic
951503872 3:23419517-23419539 AGTGACCCACCAGAATTACCTGG + Intronic
952210568 3:31225510-31225532 CCTGGGCCCCAAGAATGGCCTGG - Intergenic
954755087 3:52834829-52834851 TCTGAGCCCCAAGCATGAACTGG - Intronic
957445413 3:80308991-80309013 AATGAGTCCCAGGAATAACCAGG + Intergenic
963904990 3:150765960-150765982 TGTGAGCCACATCAATGACCAGG + Intergenic
964488300 3:157208559-157208581 AGAGAGCCCCAAGAATGCCTTGG + Intergenic
966647955 3:182268095-182268117 AGTAAGCTCCCAGTATGACCAGG - Intergenic
967669035 3:192210395-192210417 TGTGAGCTCCAAGAATTATCTGG - Intronic
969960858 4:10943650-10943672 AATGAGCTGCAAGAATGACTGGG - Intergenic
974802529 4:66836802-66836824 AGTGAGCCCTAAGAAAGTTCGGG - Intergenic
974962006 4:68714242-68714264 TGGGAGCCCCAAGAACTACCTGG - Intergenic
978615364 4:110588152-110588174 AGTGAACCCCAGGAAGGGCCTGG + Intergenic
979745467 4:124207029-124207051 AGTGAGCCACAAGAACAACTTGG - Intergenic
981841384 4:149116669-149116691 ATTCAGCCACAAGAATGACTGGG - Intergenic
984092852 4:175396033-175396055 GGTGAGCCCAATGAATGACAAGG - Intergenic
984143855 4:176037029-176037051 AGTGAGACCCACGAATGGCTGGG + Intergenic
990262623 5:54041561-54041583 CATGAGCCACAAGTATGACCTGG + Intronic
990369969 5:55107806-55107828 AGTGAGCCCCAAGAATGACCTGG - Exonic
995924606 5:117355914-117355936 AGTGAGTCCCAAGGTTGATCAGG - Intergenic
1005064488 6:21805258-21805280 AGTGAGCCCCCAGAACAACCAGG - Intergenic
1008142224 6:47845113-47845135 AGTGAGCTTGAAGAATGACTGGG - Intergenic
1016909348 6:149182184-149182206 AGTGAGCCCCACCACTGACAAGG + Intergenic
1018699199 6:166413216-166413238 AGCGAGCCCCAAAACAGACCTGG - Intronic
1022258967 7:28685740-28685762 AGAGAGCTCCAAGAGGGACCCGG - Intronic
1029502361 7:100939793-100939815 AGTGAGCCCCAAGCCTGCCTGGG + Intergenic
1032889988 7:136183781-136183803 AATGATCCCCAAGGATAACCAGG + Intergenic
1037627522 8:20620974-20620996 AGTGAGCTCCCAGAAAGGCCTGG + Intergenic
1046681121 8:117171355-117171377 AGTCAGCCCCAAGAATGTCGTGG - Intronic
1047979712 8:130167969-130167991 AGAGAATCCTAAGAATGACCAGG + Intronic
1048951672 8:139501665-139501687 AGAGAGCCCCAAGAGTGATGTGG - Intergenic
1049031453 8:140041058-140041080 TGTGACCTCCAAGAATGACCAGG + Intronic
1049257671 8:141622644-141622666 AGTGAGCATCAAGACTGACCAGG - Intergenic
1051238940 9:15031440-15031462 AGCGAGCCCCATGAATGTCTTGG - Intergenic
1051530612 9:18098902-18098924 AGTGAGCCCCAGAATTGACCTGG - Intergenic
1051784021 9:20722097-20722119 AGTGAGCTACAATAATGCCCAGG - Intronic
1056045136 9:82706760-82706782 AGTGAGCTTCAAGTATGATCAGG + Intergenic
1059057134 9:110995658-110995680 AGGGAGCACCAAGAAAGAGCTGG + Intronic
1061236591 9:129346647-129346669 AGTTACCCCGAAGAATCACCTGG - Intergenic
1186706015 X:12139458-12139480 AGTCAGCTCCTAGATTGACCAGG + Intronic
1186827121 X:13351472-13351494 ACTCAGCCTCGAGAATGACCAGG - Intergenic
1190432153 X:50388466-50388488 AATGAGCCCCATGTCTGACCTGG + Intronic
1195973608 X:110500813-110500835 AGTGAACTTCAAGAATGACAGGG + Intergenic
1196481391 X:116153963-116153985 AGTGTGACACAACAATGACCAGG - Intergenic