ID: 990371385

View in Genome Browser
Species Human (GRCh38)
Location 5:55122522-55122544
Sequence ATTGATGGAGGGAATGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 193}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990371385_990371396 29 Left 990371385 5:55122522-55122544 CCTCGCCCATTCCCTCCATCAAT 0: 1
1: 0
2: 2
3: 19
4: 193
Right 990371396 5:55122574-55122596 TGTGGGACTTGTGACTATCCTGG 0: 1
1: 0
2: 2
3: 4
4: 92
990371385_990371392 11 Left 990371385 5:55122522-55122544 CCTCGCCCATTCCCTCCATCAAT 0: 1
1: 0
2: 2
3: 19
4: 193
Right 990371392 5:55122556-55122578 AATTCCTCTACCTTTGAATGTGG 0: 1
1: 1
2: 7
3: 74
4: 341
990371385_990371393 12 Left 990371385 5:55122522-55122544 CCTCGCCCATTCCCTCCATCAAT 0: 1
1: 0
2: 2
3: 19
4: 193
Right 990371393 5:55122557-55122579 ATTCCTCTACCTTTGAATGTGGG 0: 1
1: 1
2: 13
3: 90
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990371385 Original CRISPR ATTGATGGAGGGAATGGGCG AGG (reversed) Intronic