ID: 990373207

View in Genome Browser
Species Human (GRCh38)
Location 5:55142090-55142112
Sequence GCTTCTGTTCTGTGGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990373201_990373207 10 Left 990373201 5:55142057-55142079 CCACAAAGCTGATCACAGCAAGG 0: 1
1: 0
2: 1
3: 16
4: 208
Right 990373207 5:55142090-55142112 GCTTCTGTTCTGTGGGTGCAGGG No data
990373200_990373207 19 Left 990373200 5:55142048-55142070 CCACAGTTACCACAAAGCTGATC 0: 1
1: 0
2: 0
3: 6
4: 155
Right 990373207 5:55142090-55142112 GCTTCTGTTCTGTGGGTGCAGGG No data
990373199_990373207 20 Left 990373199 5:55142047-55142069 CCCACAGTTACCACAAAGCTGAT 0: 1
1: 0
2: 1
3: 20
4: 144
Right 990373207 5:55142090-55142112 GCTTCTGTTCTGTGGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990373207 Original CRISPR GCTTCTGTTCTGTGGGTGCA GGG Intronic
No off target data available for this crispr