ID: 990375430

View in Genome Browser
Species Human (GRCh38)
Location 5:55165887-55165909
Sequence CTAAGGTGTTTTAAGTGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990375428_990375430 11 Left 990375428 5:55165853-55165875 CCTTTGCAACTCTAAAAGTCAAT 0: 1
1: 0
2: 4
3: 49
4: 346
Right 990375430 5:55165887-55165909 CTAAGGTGTTTTAAGTGACCAGG 0: 1
1: 0
2: 1
3: 10
4: 86
990375427_990375430 12 Left 990375427 5:55165852-55165874 CCCTTTGCAACTCTAAAAGTCAA 0: 1
1: 0
2: 1
3: 12
4: 278
Right 990375430 5:55165887-55165909 CTAAGGTGTTTTAAGTGACCAGG 0: 1
1: 0
2: 1
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990375430 Original CRISPR CTAAGGTGTTTTAAGTGACC AGG Intronic
905333337 1:37224914-37224936 CAAATCTGTTTTAAGTAACCTGG - Intergenic
907679219 1:56548069-56548091 CTAAGGTGGTTGGAGTAACCTGG + Intronic
907991139 1:59583979-59584001 CTCAGGTGGTTTAAAAGACCAGG + Intronic
915668300 1:157464954-157464976 CAAATGTGTTTGATGTGACCTGG + Intergenic
917089147 1:171335404-171335426 CTAACGCGTATTAAGTGACAGGG + Intronic
917494440 1:175527283-175527305 CAAAGGTGTTTTAAATGGCATGG + Intronic
918399732 1:184151659-184151681 GCAAGGTGTTTTCAGTGACAGGG + Intergenic
919194907 1:194271903-194271925 CTCAAGTGTTTTAAGTCAGCAGG - Intergenic
923931284 1:238700731-238700753 TTCAGCTGTTTTAAGTGAACTGG - Intergenic
924390939 1:243556252-243556274 CTAATGTGTTTTAACTCACCTGG - Intronic
1065780024 10:29158623-29158645 CTAAGTTGCTTTCAGTCACCAGG - Intergenic
1068851341 10:61745309-61745331 ATAAGTGGTATTAAGTGACCTGG - Intronic
1074757692 10:116637753-116637775 CTAAGGTGTATTAAGTAAGAAGG + Intronic
1077923998 11:6662499-6662521 CTGCCGTCTTTTAAGTGACCTGG - Intergenic
1078255660 11:9656514-9656536 CTAAAGTCTTTTAAGAGACAGGG + Intergenic
1079011777 11:16834429-16834451 CAAAGGTGTTTGTAGGGACCAGG + Intronic
1079426774 11:20351060-20351082 TTAAGATGTTTTATGTGACATGG - Intergenic
1080380898 11:31771465-31771487 CTAAAGTGTAGTAAGTGACTTGG - Intronic
1082976644 11:59079234-59079256 GAAAGGTGTTTTAACTGACTGGG - Intergenic
1088882656 11:113983889-113983911 TTGAGGGGTTTTAAGTGACACGG - Intronic
1089872092 11:121684442-121684464 CTAAAGTATTCTTAGTGACCAGG + Intergenic
1090933656 11:131322581-131322603 CTAAGTTGTTTCAAGTCACTTGG + Intergenic
1093500449 12:19806097-19806119 CTAAGGTGTATTGAGTGAGCTGG + Intergenic
1098870305 12:75810088-75810110 CTAAGGAGTTTTCAGGGACATGG + Intergenic
1103693354 12:122793754-122793776 CTAAGAAGTTTTAAGTGAAATGG + Intronic
1103706668 12:122878426-122878448 CGAAGGTGTTGTAAGTCTCCTGG + Intronic
1111362591 13:87194665-87194687 CTCAGGTGATTTAAGTGACCTGG - Intergenic
1116919603 14:50559356-50559378 CTTAGTTGTTTTCAGTAACCTGG - Intronic
1131058975 15:89392787-89392809 CTCAGCTATCTTAAGTGACCTGG - Intergenic
1133410772 16:5566904-5566926 CCAAGTTGTTTTAGGTGACCTGG + Intergenic
1134601619 16:15538145-15538167 CTAAGGGCTTTTTAATGACCTGG - Intronic
1140819764 16:78652106-78652128 CAAACATCTTTTAAGTGACCAGG - Intronic
1141842573 16:86583609-86583631 CACAGGTGTTTACAGTGACCTGG + Intergenic
1146842303 17:36164401-36164423 CAAGAGTGTTTTCAGTGACCCGG + Intergenic
1146854613 17:36252360-36252382 CAAGAGTGTTTTCAGTGACCCGG + Intronic
1146866007 17:36336016-36336038 CAAGAGTGTTTTCAGTGACCCGG - Intronic
1146870513 17:36376252-36376274 CAAGAGTGTTTTCAGTGACCCGG + Intronic
1146877871 17:36427333-36427355 CAAGAGTGTTTTCAGTGACCCGG + Intronic
1147068876 17:37936628-37936650 CAAGAGTGTTTTCAGTGACCCGG - Intergenic
1147073396 17:37976876-37976898 CAAGAGTGTTTTCAGTGACCCGG + Intergenic
1147080400 17:38016165-38016187 CAAGAGTGTTTTCAGTGACCCGG - Intronic
1147084918 17:38056414-38056436 CAAGAGTGTTTTCAGTGACCCGG + Intronic
1147096347 17:38140125-38140147 CAAGAGTGTTTTCAGTGACCCGG - Intergenic
1147100865 17:38180380-38180402 CAAGAGTGTTTTCAGTGACCCGG + Intergenic
1148988323 17:51643776-51643798 CTAAGTTGTCTTAAGGTACCTGG - Intronic
1148996721 17:51716590-51716612 CTAAGGTGATGTCAGTGACATGG + Intronic
1149845457 17:60006844-60006866 CAAGAGTGTTTTCAGTGACCCGG + Intergenic
1150083806 17:62263427-62263449 CAAGAGTGTTTTCAGTGACCCGG + Intergenic
1153560063 18:6362703-6362725 CTAAGATGTTGTAAGTTACCAGG - Intronic
1155569074 18:27170220-27170242 ATAGGATGTTTTAAGGGACCAGG - Intronic
1155676093 18:28430603-28430625 CTAAAATATTTTAAGTGACAGGG - Intergenic
1155807266 18:30187537-30187559 CTAATGTGTTTAAAGTTATCTGG + Intergenic
926641462 2:15242424-15242446 GTAAGGTGTTTTATTTGACTAGG + Intronic
926772871 2:16393747-16393769 TAAAAGTATTTTAAGTGACCTGG + Intergenic
927530203 2:23790539-23790561 CTAAGGTGTTGGTAGTAACCTGG - Intronic
932292296 2:70592782-70592804 CTTATGTGTTTTAAGTGAAAAGG + Intergenic
935816501 2:106850990-106851012 CTACGATGGTTTAAGTGACTGGG + Intronic
941573292 2:167198494-167198516 CTAATGTGCTTTAAGTGAAAAGG - Intronic
1170104479 20:12738607-12738629 CTAAGGGGCTTTTCGTGACCTGG - Intergenic
1172439377 20:34954993-34955015 GTCAGGTGTCTTCAGTGACCAGG + Intronic
1174983669 20:55424913-55424935 GTAAAATGTTTTAAGTGACTCGG + Intergenic
1183803624 22:40189748-40189770 TTAAAGTGTTTGAAGAGACCTGG - Intronic
958187743 3:90145013-90145035 ATAAGGTGCTTTCAGAGACCTGG - Intergenic
962263541 3:133929577-133929599 CAAAGCTGGTTTAAGTGTCCCGG + Exonic
962887724 3:139642850-139642872 TTCAGGTTTTTTAAGTCACCAGG - Intronic
965740150 3:171865733-171865755 CTAAAGTGGTTAAAGTGATCTGG - Intronic
971934164 4:33125977-33125999 CCAAGGTTTCTTAATTGACCTGG - Intergenic
975624167 4:76326254-76326276 CTAATGTGATTAAATTGACCTGG + Intronic
976659157 4:87521240-87521262 CTAAGTTGATTTAAGTGGCATGG - Intronic
978202263 4:106035942-106035964 CTAAGGTCTCTTTAGTTACCTGG + Intergenic
981414318 4:144471787-144471809 GGAAGCTGTTTTAAGTGAACAGG + Intergenic
990375430 5:55165887-55165909 CTAAGGTGTTTTAAGTGACCAGG + Intronic
992129040 5:73673047-73673069 CTAAGCTGCTTTAAGTGAAAGGG - Intronic
994488788 5:100414986-100415008 CTACTTTGTTATAAGTGACCTGG + Intergenic
995645023 5:114301857-114301879 CTGAGGTTTGTTAAGTGACCAGG + Intergenic
1005116598 6:22345356-22345378 CTTAGGTGTTTTAAATAACAAGG + Intergenic
1006809006 6:36807874-36807896 CTAAGGTTTTCTTAGAGACCTGG + Intronic
1012548367 6:100446772-100446794 CAAAGGGGGCTTAAGTGACCAGG - Intronic
1023755178 7:43409453-43409475 TAAAGGTGTTTTAAGTGTCAGGG + Intronic
1025974498 7:66359114-66359136 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974536 7:66359300-66359322 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974548 7:66359360-66359382 CTAAGGTTCTTTAAGTGTCCAGG - Intronic
1025974561 7:66359423-66359445 CTAAGGTTCTTCAAGTGTCCAGG - Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1030428755 7:109415235-109415257 CTAAAGTGTTCTAAGTGTTCTGG - Intergenic
1034012909 7:147549569-147549591 CTGCGGAGCTTTAAGTGACCAGG + Intronic
1036163696 8:6411484-6411506 TTAAGGTGCTTTAAGTGAAAAGG + Intronic
1036531166 8:9588827-9588849 CTATGGTTCTTTTAGTGACCAGG + Intronic
1038753209 8:30316055-30316077 AAAAGGTGTTGTAAGAGACCTGG + Intergenic
1040908984 8:52499123-52499145 CTAAGATATTTTAAGTTTCCTGG + Intergenic
1040909111 8:52500743-52500765 CTAAGATGTTTTAAGTTTCCTGG + Intergenic
1044367106 8:91360678-91360700 CTATGGTTTTTTAAGTGGCAGGG + Intronic
1046670332 8:117049941-117049963 TTAAAGTGTTTAAAGTGACCCGG + Intronic
1049975396 9:856883-856905 CTAAGTTTTTTTAAGTTACAAGG + Intronic
1052183258 9:25557833-25557855 CTGGGGTTTTTTAAGTAACCTGG - Intergenic
1060764235 9:126281940-126281962 CTTGGGTGTTGTAAGTGGCCTGG - Intergenic
1197034976 X:121862426-121862448 CTAAAGTTTTTTAATTGTCCAGG - Intergenic
1202028048 Y:20545178-20545200 CCAAGGTGTCTCAAGAGACCTGG + Intergenic