ID: 990376678

View in Genome Browser
Species Human (GRCh38)
Location 5:55177291-55177313
Sequence ATAGGGTAACTGCCCAAATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990376675_990376678 -5 Left 990376675 5:55177273-55177295 CCTTAGGGTCGTTCTTGCATAGG No data
Right 990376678 5:55177291-55177313 ATAGGGTAACTGCCCAAATAAGG No data
990376670_990376678 24 Left 990376670 5:55177244-55177266 CCTTTAGGGCATTTTTCCTTTCA No data
Right 990376678 5:55177291-55177313 ATAGGGTAACTGCCCAAATAAGG No data
990376674_990376678 -2 Left 990376674 5:55177270-55177292 CCTCCTTAGGGTCGTTCTTGCAT No data
Right 990376678 5:55177291-55177313 ATAGGGTAACTGCCCAAATAAGG No data
990376673_990376678 8 Left 990376673 5:55177260-55177282 CCTTTCACATCCTCCTTAGGGTC No data
Right 990376678 5:55177291-55177313 ATAGGGTAACTGCCCAAATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990376678 Original CRISPR ATAGGGTAACTGCCCAAATA AGG Intergenic
No off target data available for this crispr