ID: 990377849

View in Genome Browser
Species Human (GRCh38)
Location 5:55190608-55190630
Sequence GAGAGTAACAAATACGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990377843_990377849 9 Left 990377843 5:55190576-55190598 CCCTGGGTATTATGGAGTGGAGG No data
Right 990377849 5:55190608-55190630 GAGAGTAACAAATACGAGGAGGG No data
990377845_990377849 8 Left 990377845 5:55190577-55190599 CCTGGGTATTATGGAGTGGAGGA No data
Right 990377849 5:55190608-55190630 GAGAGTAACAAATACGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990377849 Original CRISPR GAGAGTAACAAATACGAGGA GGG Intergenic
No off target data available for this crispr