ID: 990378935

View in Genome Browser
Species Human (GRCh38)
Location 5:55202422-55202444
Sequence GGCCGAGGGCGGGTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990378925_990378935 19 Left 990378925 5:55202380-55202402 CCAGGTGTGGAGGCTCACACTTG 0: 3
1: 256
2: 5890
3: 25619
4: 76254
Right 990378935 5:55202422-55202444 GGCCGAGGGCGGGTGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990378935 Original CRISPR GGCCGAGGGCGGGTGGGGGC AGG Intergenic
No off target data available for this crispr