HTGT WGE

Individual CRISPR Summary

ID: 990382518

 View in Genome Browser
Species Human (GRCh38)
Location 5:55231485-55231507
Sequence CCACCCGGAGGCGGCGCTGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990382518_990382525 0 Complete closest: None
total_pairs: 1
max_distance: 1000		 Left 990382518 5:55231485-55231507 CCTCCAGCGCCGCCTCCGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 267
Right 990382525 5:55231508-55231530 TCTCCCAGTCGCAAGTCCACGGG 0: 1
1: 0
2: 0
3: 7
4: 99
990382518_990382529 22 Complete closest: None
total_pairs: 1
max_distance: 1000		 Left 990382518 5:55231485-55231507 CCTCCAGCGCCGCCTCCGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 267
Right 990382529 5:55231530-55231552 GCCGCGAGACCCGCAGCATGCGG 0: 1
1: 0
2: 0
3: 7
4: 62
990382518_990382524 -1 Complete closest: None
total_pairs: 1
max_distance: 1000		 Left 990382518 5:55231485-55231507 CCTCCAGCGCCGCCTCCGGGTGG 0: 1
1: 0
2: 1
3: 18
4: 267
Right 990382524 5:55231507-55231529 GTCTCCCAGTCGCAAGTCCACGG 0: 1
1: 0
2: 1
3: 9
4: 91

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990382518 Original CRISPR CCACCCGGAGGCGGCGCTGG AGG (reversed) Exonic