ID: 990383017

View in Genome Browser
Species Human (GRCh38)
Location 5:55233844-55233866
Sequence ACCGGAGCCCGGGTCGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990383010_990383017 1 Left 990383010 5:55233820-55233842 CCTGCGTCCTGCGTTACCTGGGC 0: 1
1: 0
2: 1
3: 3
4: 84
Right 990383017 5:55233844-55233866 ACCGGAGCCCGGGTCGCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 107
990383006_990383017 13 Left 990383006 5:55233808-55233830 CCGCCTTTCGCGCCTGCGTCCTG 0: 1
1: 0
2: 1
3: 2
4: 86
Right 990383017 5:55233844-55233866 ACCGGAGCCCGGGTCGCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 107
990383007_990383017 10 Left 990383007 5:55233811-55233833 CCTTTCGCGCCTGCGTCCTGCGT 0: 1
1: 0
2: 0
3: 2
4: 38
Right 990383017 5:55233844-55233866 ACCGGAGCCCGGGTCGCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 107
990383012_990383017 -6 Left 990383012 5:55233827-55233849 CCTGCGTTACCTGGGCAACCGGA 0: 1
1: 0
2: 0
3: 2
4: 35
Right 990383017 5:55233844-55233866 ACCGGAGCCCGGGTCGCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 107
990383004_990383017 21 Left 990383004 5:55233800-55233822 CCAGGCACCCGCCTTTCGCGCCT 0: 1
1: 0
2: 1
3: 10
4: 82
Right 990383017 5:55233844-55233866 ACCGGAGCCCGGGTCGCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 107
990383005_990383017 14 Left 990383005 5:55233807-55233829 CCCGCCTTTCGCGCCTGCGTCCT 0: 1
1: 0
2: 0
3: 6
4: 94
Right 990383017 5:55233844-55233866 ACCGGAGCCCGGGTCGCTGCGGG 0: 1
1: 0
2: 0
3: 6
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990383017 Original CRISPR ACCGGAGCCCGGGTCGCTGC GGG Intergenic