ID: 990387014

View in Genome Browser
Species Human (GRCh38)
Location 5:55274946-55274968
Sequence CTGCTGTACTTTTGGTAAAA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990387011_990387014 27 Left 990387011 5:55274896-55274918 CCAGGTTGATTTTATGAGGATTC 0: 2
1: 0
2: 1
3: 6
4: 143
Right 990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG 0: 1
1: 0
2: 1
3: 20
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990387014 Original CRISPR CTGCTGTACTTTTGGTAAAA TGG Exonic
901586378 1:10297262-10297284 CTGCTAAACTGTTGGGAAAAGGG + Intronic
903646393 1:24898653-24898675 CTGCTGTCTTTTGGGTAAAAGGG + Intergenic
905265477 1:36751556-36751578 CTGCTGTACTGTTTGCCAAAGGG - Intergenic
908661032 1:66435300-66435322 CTGCTTTACTACTGGGAAAAGGG - Intergenic
908989236 1:70065258-70065280 CTCCTGAACTTTTGCTTAAAAGG - Intronic
911039428 1:93579985-93580007 CTGCTGTACTTTTGGCCAGATGG - Intronic
911655472 1:100437908-100437930 CTGCTTTACGTTTTTTAAAAGGG - Intronic
913194864 1:116447420-116447442 CGTCTATACTTTTGATAAAAGGG + Intergenic
913426820 1:118740481-118740503 CTGCAGCACTTTTGGTGAAAGGG - Intergenic
914444165 1:147735671-147735693 CAGCTGTACTTGTGGTGACAGGG + Intergenic
915847711 1:159285388-159285410 CTTCTGTACTTTTTATAAATTGG + Intergenic
917020986 1:170586680-170586702 CTGCTCTGCTTTTGTTGAAATGG + Intergenic
917021541 1:170593732-170593754 GTTCTGTTCTTTTCGTAAAATGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919108001 1:193177983-193178005 CAGCTTTGCTTTTGGTCAAAGGG - Intronic
919151354 1:193704039-193704061 TTGCTTTCCTTTTGGTAAACTGG - Intergenic
919169061 1:193930939-193930961 CTGGTGTACTTTTGGTACTTTGG + Intergenic
919475156 1:198023658-198023680 GGCCTGTACTTGTGGTAAAATGG - Intergenic
920871548 1:209799160-209799182 CAGCTCTCCCTTTGGTAAAATGG - Intronic
922541589 1:226424333-226424355 CTGTTGTCCTTTTAGGAAAAGGG + Intergenic
923103669 1:230837684-230837706 TTGCTGTGCTTTTGGAAGAAGGG - Exonic
923198770 1:231692153-231692175 TAGCTGTATTATTGGTAAAATGG + Intronic
923199021 1:231694049-231694071 CTGCTGCACTCTTGGAAACAGGG - Exonic
923295687 1:232592873-232592895 CTGCTGTACGACTGGAAAAATGG + Intergenic
923646277 1:235823616-235823638 TTGCTTTGCTTTTGGTAAAACGG - Intronic
924517095 1:244775211-244775233 CTCCTGTGCTTTTGGCAATAAGG - Intergenic
1065596400 10:27317007-27317029 TTTTTGTACTTTTGGTAAGACGG + Intergenic
1069635283 10:69921301-69921323 CTGATGTCCTTTTTATAAAAGGG - Intronic
1071284273 10:84129835-84129857 TTGCGGTACTATTGCTAAAATGG + Intergenic
1074173236 10:110966840-110966862 TTGCTGTACTTCTGTAAAAATGG + Intronic
1074470218 10:113720067-113720089 CTGCTAGACTTTTGGCAAACTGG + Intronic
1074505376 10:114065409-114065431 CTGCTTCAGTTTTCGTAAAAGGG - Intergenic
1074517329 10:114182241-114182263 CTGCAGTGTTTTTTGTAAAATGG - Intronic
1079959130 11:26901053-26901075 ATACTGTATTTCTGGTAAAATGG - Intergenic
1080321538 11:31015625-31015647 CTGCTGAACATTTGGAGAAAAGG + Intronic
1081104893 11:39054162-39054184 CTCAAGTACTTTTTGTAAAATGG - Intergenic
1082645260 11:55715809-55715831 CTGCTTTACTGTTTGAAAAAGGG - Intergenic
1083284912 11:61652170-61652192 CTCCTGTATTTCTGGTAAACTGG - Intergenic
1083799428 11:65037961-65037983 CTGGTGCACCTTTGGTGAAAAGG - Intronic
1085848089 11:80088571-80088593 CAGGTATACTTTTGATAAAAGGG + Intergenic
1087324043 11:96699336-96699358 CTGCAGTACCTTTTGGAAAATGG + Intergenic
1087443161 11:98210358-98210380 CTCCTGTCCTTTTTATAAAATGG + Intergenic
1088475487 11:110234087-110234109 CTGGAGTACTTTTGAGAAAAAGG - Intronic
1091834218 12:3573929-3573951 CTGCTCCACTTCTGATAAAAAGG + Intronic
1091904643 12:4174612-4174634 TTGCTTTACTCTTGGTGAAAGGG - Intergenic
1093089998 12:14910436-14910458 GTGTTGAACTTTTGGAAAAAAGG - Intergenic
1093827037 12:23705592-23705614 CTGCTGCTCTTTTTGTATAAAGG + Intronic
1094237583 12:28186413-28186435 CTGCTGTACTCTTCCTAGAAAGG + Intronic
1095360139 12:41327472-41327494 CTGCTTTAATTTTGGGAAAGTGG + Intronic
1096208714 12:49745333-49745355 CGTCTGTACTTTTGTTTAAATGG - Intronic
1099219048 12:79890584-79890606 TTGATATACTTTTGTTAAAAAGG - Intronic
1099520820 12:83659327-83659349 CTGTAGTACTTGTGGTAACATGG + Intergenic
1103099662 12:118162254-118162276 CTACTGTACTCTCTGTAAAATGG + Intronic
1104097889 12:125575995-125576017 CTTGTGTACTTCTGGAAAAAAGG + Intronic
1105735814 13:23269116-23269138 GAGATGTACTTTTGGAAAAAAGG + Intronic
1106202477 13:27551881-27551903 CTGCTCTGCTTTTCGTGAAAAGG - Intronic
1106988173 13:35381318-35381340 ATGCTGTACACTTTGTAAAATGG + Intronic
1107076495 13:36326346-36326368 CTGTTCTACTATTGGGAAAATGG - Intronic
1107613522 13:42140659-42140681 CTGATGTACTTTTTGAAGAAGGG + Intronic
1107651886 13:42553181-42553203 CTGCTGTCCTACTGGTGAAAAGG - Intergenic
1112255935 13:97831272-97831294 TTGGTGTACATTTGGTACAATGG - Intergenic
1113176244 13:107567638-107567660 CTTCTGTACTTGTGGTTGAATGG + Intronic
1114596258 14:23914710-23914732 CTGCAGTCCTTGTGTTAAAATGG - Intergenic
1115710474 14:36045193-36045215 CTTCTGTATTTTTTGAAAAATGG + Intergenic
1116724848 14:48550124-48550146 CAGGTGTCTTTTTGGTAAAATGG - Intergenic
1118503100 14:66381784-66381806 TTGCTGGACTTTTGATGAAATGG - Intergenic
1120020378 14:79523621-79523643 CTGCTTTATTTTTGTCAAAATGG + Intronic
1121640067 14:95479431-95479453 CACCTGTGCGTTTGGTAAAAAGG - Intergenic
1125244809 15:37622794-37622816 CTGCTATTCTTTAGGTAAATGGG + Intergenic
1127027855 15:54827878-54827900 CTGGTTTATTTTTGGGAAAAGGG + Intergenic
1130019530 15:80216228-80216250 CTGCTGGACATATGGCAAAAGGG + Intergenic
1131046071 15:89316655-89316677 CAGCTGTGCTTTTTGCAAAAGGG - Exonic
1134315291 16:13113346-13113368 CTGCTGTCTCTTTGGTAAGAGGG + Intronic
1135716654 16:24776032-24776054 CTGCTGTTTTCTCGGTAAAATGG - Intronic
1140705282 16:77623116-77623138 TTGGTGTACATGTGGTAAAAAGG - Intergenic
1146531840 17:33614059-33614081 CACCTGTACTGTTGGTAGAAAGG - Intronic
1147261964 17:39214008-39214030 CTGCTGTACCTGTGGTCACATGG - Intronic
1147940910 17:44047101-44047123 CTGCTATACTTCTGCTAAAATGG - Intronic
1148040677 17:44704235-44704257 CAGGTGTCCTTTTGGTAGAATGG + Intergenic
1155001550 18:21692321-21692343 CTGCTTTTTGTTTGGTAAAATGG + Intronic
1155725041 18:29070855-29070877 GTGCTTTAATTTTGGTATAAAGG - Intergenic
1156794305 18:41023637-41023659 ATGTAGTTCTTTTGGTAAAAAGG + Intergenic
1157984715 18:52423990-52424012 ATCCTGGACTTTTGGTAGAAAGG - Intronic
1160925762 19:1544710-1544732 TTGTTGTATTTTTGGTAAAGAGG + Intergenic
1164580396 19:29431316-29431338 CTGCTGCAATTTTTGTAATAAGG - Intergenic
925715651 2:6782237-6782259 CTGCTGTGCTGTTGGTCAACCGG - Intergenic
925872995 2:8286778-8286800 CTGCTCTAATTTTGCTACAAGGG - Intergenic
929376592 2:41294447-41294469 CTGCTGTCCTTCTGAGAAAAAGG + Intergenic
930974529 2:57441693-57441715 TTGGTGTACTCTTGGTAATAAGG - Intergenic
933724864 2:85420958-85420980 CGGCTTTTCTGTTGGTAAAAGGG + Intronic
937599782 2:123717381-123717403 CTTGTGTACTTTTGGTAAGAAGG - Intergenic
939000703 2:136730701-136730723 GAGCTGTAATTCTGGTAAAAGGG + Intergenic
939619298 2:144398873-144398895 CTGGTTTAATATTGGTAAAATGG + Exonic
939896872 2:147801992-147802014 CTGCTGTACTTTCTAGAAAAGGG - Intergenic
940792164 2:158040547-158040569 CTGTGGTACTTTTGGCAAATGGG + Intronic
940839671 2:158565501-158565523 CTGCTCTTTTTTTGGTAAACAGG + Intronic
941338352 2:164273157-164273179 CAGCTGTAATTTTAGTAGAAAGG - Intergenic
941377254 2:164746890-164746912 CTGCTTTACTTTTGGCCACAGGG + Intronic
942933979 2:181531692-181531714 CTTGTGTAATTTTGGGAAAATGG + Exonic
944341280 2:198603546-198603568 CTGCTGTACATGTATTAAAATGG + Intergenic
946814292 2:223560485-223560507 ATGCTGCAATTTTGATAAAATGG + Intergenic
947307997 2:228768344-228768366 CTGCTGTTCTTATGGTAATGAGG - Intergenic
948060752 2:235041981-235042003 CCACTGTGCTTTTGCTAAAAAGG - Exonic
1170083148 20:12498791-12498813 CTGCTTTAATTTCTGTAAAATGG + Intergenic
1171145437 20:22777360-22777382 GAGCTGTACTATGGGTAAAATGG - Intergenic
1173119479 20:40275815-40275837 CTGCTGTATTTTTGGAAACGGGG - Intergenic
1173135740 20:40437334-40437356 CTTCTTCACTTTTGGTACAATGG - Intergenic
1174117199 20:48234588-48234610 CTGAGGTCCTTTGGGTAAAATGG - Intergenic
1174979458 20:55376678-55376700 AAGCTTTACTTTTGTTAAAATGG - Intergenic
1175211131 20:57356565-57356587 ATTCTGTACTTTAAGTAAAATGG - Intronic
1177643828 21:23877187-23877209 CTGCTGTACTTTTTCTGACAAGG - Intergenic
1179156461 21:38855947-38855969 TTGCAGTACGTTTGCTAAAATGG - Intergenic
949503768 3:4706835-4706857 CTGCTCTCCTTTTGTTAAAGGGG + Intronic
949503883 3:4708275-4708297 CTGCTCTCCCTTTGTTAAAAGGG + Intronic
949791771 3:7800781-7800803 CACCTGTGATTTTGGTAAAAAGG - Intergenic
953263560 3:41363811-41363833 CTGCTGTAATCTTCATAAAAGGG + Intronic
953435240 3:42872638-42872660 CAGCAGTGCTTTTGGCAAAAAGG + Exonic
953521325 3:43645976-43645998 TTTTTGTATTTTTGGTAAAAAGG + Intronic
954788375 3:53112319-53112341 CTCCTATACTTTGTGTAAAAGGG - Intronic
955917442 3:63921001-63921023 TTACTGTACTTTTGAGAAAAAGG + Intronic
956352247 3:68350650-68350672 CTGCTGTTTTTCTGTTAAAAAGG - Intronic
959270916 3:104208549-104208571 CTTCTGTCCTTTTGCTAAAATGG + Intergenic
959871538 3:111334157-111334179 CTGCTGCACTTTTTCTAAAACGG - Intronic
960649843 3:119934738-119934760 TTACTGTATTGTTGGTAAAAAGG + Intronic
961122947 3:124389049-124389071 CTGCTCAACTTTTGCTAAAGTGG + Intronic
961696874 3:128711474-128711496 CTTTTGTATTTTTTGTAAAAAGG + Intergenic
963441256 3:145343262-145343284 CTGCTGGACTTTTCATAAAGAGG + Intergenic
963961320 3:151312431-151312453 CTGCTGCCCTTTTGGTATACTGG + Intronic
965441399 3:168719636-168719658 CTTCAGTGCTTTTGGAAAAAGGG - Intergenic
966508396 3:180733022-180733044 CAGTTGTACTTTCTGTAAAATGG + Intronic
966568842 3:181417080-181417102 CTGCAGTACATTTTGTAATATGG - Intergenic
967375520 3:188796386-188796408 TTCCTGTACTTTTGGGAAAAAGG - Intronic
970371702 4:15413609-15413631 CTGCTGTACTTTTTGCTAAAAGG + Intronic
971483201 4:27132550-27132572 CTACTGTAGTTTTGGTAGGAGGG + Intergenic
973130696 4:46645018-46645040 CTACAGTACTTTTGAGAAAATGG + Intergenic
974672462 4:65049942-65049964 CTTCAGTAGTTTTGGTAAAAAGG - Intergenic
979008127 4:115330664-115330686 CTGTTTTACTGTTGGGAAAATGG + Intergenic
979243016 4:118465816-118465838 CTGCTGTGTTTTCAGTAAAAGGG - Intergenic
979848164 4:125543367-125543389 CTTCTGAACTGTTGGTAAACAGG + Intergenic
981288431 4:143046509-143046531 CTGCTGTACTGTTGAACAAAGGG + Intergenic
984041714 4:174743525-174743547 CTGCAGCATTTTTGTTAAAAAGG - Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
984933053 4:184865051-184865073 CTGCTGTACTTTTGTTTTGATGG - Intergenic
985745132 5:1642574-1642596 ATGCTTTTCTTTTAGTAAAAGGG + Intergenic
986317614 5:6601077-6601099 CTGCTTTACATTAGGAAAAATGG - Intronic
987836037 5:23163351-23163373 CTGCTGAAATTTTGTTAAGATGG + Intergenic
988050456 5:26022911-26022933 CTTCTGTACTTTTAGTAGAGAGG + Intergenic
990365887 5:55069835-55069857 CTGCTTTCCTTTTGGTAAACAGG + Intergenic
990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG + Exonic
991729019 5:69564296-69564318 CTCTTGTACTTTTGGTAGAATGG + Intronic
991805450 5:70419444-70419466 CTCTTGTACTTTTGGTAGAATGG + Intergenic
991865935 5:71063579-71063601 CTCTTGTACTTTTGGTAGAATGG - Intronic
992312384 5:75513387-75513409 CAGCTGTATTTTTGGAAAAGTGG + Intronic
992809141 5:80369285-80369307 CTCCTGTTCCTTTGCTAAAAGGG + Intergenic
999338845 5:150749398-150749420 CTGCTGTACATGTGCTAGAATGG + Intronic
1000758524 5:165191139-165191161 CTACTTTTCTCTTGGTAAAAAGG - Intergenic
1001251780 5:170152452-170152474 TTGCTGTCCATCTGGTAAAAAGG - Intergenic
1003012382 6:2437853-2437875 CTGCTGTAGTATTAATAAAAAGG + Intergenic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1007131923 6:39483181-39483203 CTGCTGATCTTTTGGGGAAAGGG + Intronic
1008412356 6:51194411-51194433 CTGCTGGAATTTTGAAAAAAAGG + Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1010170285 6:72967030-72967052 CTACTGTACTTTTTGTTACATGG + Intronic
1011466834 6:87666967-87666989 GTGCTGTATTTTTGACAAAAAGG - Intronic
1011988950 6:93487873-93487895 CTTCTGCCCTTTTGTTAAAAGGG + Intergenic
1013546623 6:111164400-111164422 CTGGTGTGCTATTGGTAATATGG + Intronic
1014298504 6:119650867-119650889 CTGCTTTACAGATGGTAAAATGG + Intergenic
1018649530 6:165981161-165981183 CTGCTGTACTCTAGATCAAAAGG + Intronic
1021548400 7:21842387-21842409 CTGCTGTACTTTAGGAAATTTGG + Intronic
1023308270 7:38854353-38854375 CTGCTCTACTCTTGGTCTAATGG - Intronic
1024513511 7:50221939-50221961 CTGCTGTAATCTTGGTATCATGG - Intergenic
1025937936 7:66051996-66052018 TTTCTGTATTTTTAGTAAAACGG - Intergenic
1026363477 7:69624771-69624793 CTGGTATACTTTTGGGAAGATGG - Intronic
1027825005 7:83100951-83100973 ATTTTGTACTTTTAGTAAAAAGG - Intronic
1027859510 7:83558521-83558543 CAACTGTACTTTTTGAAAAATGG - Intronic
1028264723 7:88708937-88708959 CTGCTTTACTTTGGGAGAAATGG + Intergenic
1029025715 7:97415324-97415346 GTGCTGAACTTTTGGAAGAAAGG - Intergenic
1029863978 7:103605583-103605605 CTGTGGTTCTTTTGGTCAAAGGG + Intronic
1030949605 7:115773576-115773598 CTCCTGAACTTTTATTAAAATGG + Intergenic
1031486009 7:122325568-122325590 CTGCTGTACCATTGCTAGAAGGG + Exonic
1035774313 8:2175770-2175792 CTACTGTACTTAAAGTAAAAAGG - Intergenic
1036481784 8:9146540-9146562 GTTCTGTACTTTTGGAAAAATGG - Intronic
1037158743 8:15740492-15740514 CAACTGTGCTTTTGGAAAAACGG + Intronic
1042090732 8:65156574-65156596 CTGCTGTACTTTTGGACCACTGG - Intergenic
1042422766 8:68611354-68611376 CTGCATTTCTTTTGGAAAAAGGG + Intronic
1043523363 8:81070743-81070765 ATGCTGTATTTTTGTTAACATGG + Intronic
1044031661 8:87245954-87245976 CTGCTGTACTTTAAATGAAATGG - Intronic
1044569943 8:93706183-93706205 CTTCTGTACCTTTGGTCCAAAGG - Intronic
1044807856 8:96027110-96027132 AAGCTGTACTGTGGGTAAAATGG + Intergenic
1047245864 8:123143849-123143871 CTGCTGGACTTTGGGTAAAATGG + Intronic
1047637987 8:126786818-126786840 CTGCTGTACTGTTTACAAAATGG + Intergenic
1047949910 8:129923940-129923962 CTCATTTACTTTTTGTAAAAAGG - Intronic
1050212955 9:3284775-3284797 CTCCTTTATTTTAGGTAAAATGG + Intronic
1050732273 9:8722596-8722618 TTGCTGTAATTTTGACAAAATGG + Intronic
1051614692 9:18995907-18995929 TTGTTGTATTTTTGGTAAGATGG - Intronic
1051782855 9:20709358-20709380 CTGGTTTCCTTTTAGTAAAATGG + Intronic
1051880079 9:21831037-21831059 CTCCTGTACTTGTGGTACATGGG + Intronic
1052231860 9:26164000-26164022 CTACTTTACTTATGGTATAAAGG + Intergenic
1053550563 9:39075115-39075137 CTGCAATATTTTTGGTAATAGGG - Intronic
1053814672 9:41895214-41895236 CTGCAATATTTTTGGTAATAGGG - Intronic
1054615924 9:67292227-67292249 CTGCAATATTTTTGGTAATAGGG + Intergenic
1055730264 9:79273646-79273668 CAGCTGGACTTTTTGGAAAAGGG - Intergenic
1058905550 9:109479748-109479770 CTTTTGTACTTTTGGTAGACTGG + Intronic
1059869100 9:118551270-118551292 CTTCTTTACTTTTATTAAAAAGG + Intergenic
1061978144 9:134083328-134083350 TGGCTGTAATTTTTGTAAAAAGG + Intergenic
1188397254 X:29700878-29700900 TAGCTGAACTTTTGGTAAGACGG + Intronic
1189024742 X:37381078-37381100 CTGCTGTTCTTTTTGGAGAAGGG + Intronic
1194640621 X:96399654-96399676 CTACTTTACATTAGGTAAAATGG - Intergenic
1194793119 X:98175788-98175810 CTGCTGGCCTTTTGGTATAAAGG - Intergenic
1195669016 X:107453538-107453560 TTTCTGAACTTATGGTAAAAAGG - Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196401555 X:115322458-115322480 CAGCTGTTCTTTTGGTCAAAAGG - Intergenic
1196676069 X:118421149-118421171 CTGCTTTGCTTTAGGGAAAAGGG + Intronic
1198932756 X:141878916-141878938 CTGGTGTCCTTTTTCTAAAATGG - Intronic
1201210906 Y:11679711-11679733 ATGCTGTACTTTTAATAGAATGG + Intergenic
1201344673 Y:12969228-12969250 CTGCTGCACTTTATGTAAATAGG - Intergenic