ID: 990389861

View in Genome Browser
Species Human (GRCh38)
Location 5:55307789-55307811
Sequence CAGTGGATAAAGAGCGAGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990389861_990389866 1 Left 990389861 5:55307789-55307811 CCGCCCTCGCTCTTTATCCACTG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 990389866 5:55307813-55307835 GCAGCTTATCCACTTTAGGTCGG 0: 1
1: 0
2: 0
3: 3
4: 65
990389861_990389867 6 Left 990389861 5:55307789-55307811 CCGCCCTCGCTCTTTATCCACTG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 990389867 5:55307818-55307840 TTATCCACTTTAGGTCGGAAAGG 0: 1
1: 0
2: 0
3: 1
4: 103
990389861_990389869 11 Left 990389861 5:55307789-55307811 CCGCCCTCGCTCTTTATCCACTG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 990389869 5:55307823-55307845 CACTTTAGGTCGGAAAGGAAAGG 0: 1
1: 0
2: 0
3: 6
4: 103
990389861_990389865 -3 Left 990389861 5:55307789-55307811 CCGCCCTCGCTCTTTATCCACTG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 990389865 5:55307809-55307831 CTGAGCAGCTTATCCACTTTAGG 0: 1
1: 0
2: 1
3: 5
4: 88
990389861_990389870 24 Left 990389861 5:55307789-55307811 CCGCCCTCGCTCTTTATCCACTG 0: 1
1: 0
2: 0
3: 13
4: 173
Right 990389870 5:55307836-55307858 AAAGGAAAGGAAAGAAAAGCAGG 0: 1
1: 9
2: 200
3: 1548
4: 6243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990389861 Original CRISPR CAGTGGATAAAGAGCGAGGG CGG (reversed) Exonic
900754504 1:4424388-4424410 CACTGGAGAAAAAGAGAGGGAGG - Intergenic
901855134 1:12039573-12039595 CAGTGGAGAAGGGGAGAGGGAGG + Intergenic
903451293 1:23455470-23455492 CAGAGGACAAAGAGGGAGTGAGG + Intronic
904183909 1:28687724-28687746 CAGTGGAGATAGAGACAGGGAGG + Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
907466371 1:54640456-54640478 CTGGAGATAAAGAGTGAGGGAGG + Intergenic
909883118 1:80905187-80905209 CAGTGGATAAAGAGAGTGGAAGG + Intergenic
915572034 1:156750086-156750108 GAGTGGGTACAGAGCGAGGAAGG + Intronic
916888891 1:169097446-169097468 CAGTGGAGAAACAGTGAGGAGGG + Intergenic
916996051 1:170302427-170302449 CAGTGGTTATAGAGTGAGGAAGG - Intergenic
918025857 1:180745309-180745331 CAGTGGAACAGGAGGGAGGGAGG + Intronic
919664438 1:200278729-200278751 CAGTAGAGATAGAGAGAGGGAGG + Intergenic
920309283 1:205039129-205039151 CAGAGGATGAGGAGAGAGGGAGG - Intergenic
923068453 1:230541373-230541395 CACTAGCTAAAGAGAGAGGGCGG + Intergenic
923619328 1:235565193-235565215 CAGAGGCTAAAGAAAGAGGGTGG + Intronic
924448479 1:244156294-244156316 CAGTGGGTAGAGGGTGAGGGAGG - Intergenic
1064518735 10:16178011-16178033 CAGGGGAGAAAGATCGAGGTTGG + Intergenic
1065732530 10:28722449-28722471 CAGTGGACCCAGAGCGAGGTGGG - Intergenic
1067293516 10:44961032-44961054 CAGAGGAGAAAGAGGAAGGGAGG + Intronic
1067477359 10:46575854-46575876 CAGTGGAGAAGGAGGGTGGGAGG + Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067617381 10:47765930-47765952 CAGTGGAGAAGGAGGGTGGGAGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1068711597 10:60141064-60141086 GAGGGGAAAAAGAGAGAGGGAGG + Intronic
1075908031 10:126099393-126099415 AGGTGGATAGAGAGGGAGGGAGG - Intronic
1077853628 11:6099861-6099883 CTGTGGATACAGAGCAAGGTGGG + Intergenic
1079003354 11:16775588-16775610 CAGGGGTTAGAGAGAGAGGGAGG + Intergenic
1079539028 11:21549917-21549939 GAGTGGAAAAAGAGTGAGGCAGG + Intronic
1080287707 11:30635520-30635542 CAGACAAGAAAGAGCGAGGGGGG - Intergenic
1080384274 11:31801476-31801498 CAGTGGAGAGAGAGGGTGGGAGG + Intronic
1082008988 11:47437921-47437943 CAGTGGAGAAAGAGCAGGAGTGG + Exonic
1086800465 11:91168374-91168396 CAGAGAATATAGAGCAAGGGAGG + Intergenic
1087221892 11:95555266-95555288 TAGGGGATAAAGTGCGATGGGGG - Intergenic
1089564920 11:119365712-119365734 CAGTGGTCAAAGACTGAGGGTGG - Intronic
1089579214 11:119470995-119471017 CAGAGGAGGAAGAGCCAGGGAGG - Intergenic
1089973234 11:122711163-122711185 GAGTGTATAAAGAGGAAGGGTGG - Intronic
1091330377 11:134727295-134727317 CAGTGGTCAAAGAGCCAAGGGGG - Intergenic
1091511260 12:1129018-1129040 GAGTGGATAAAGAGAATGGGAGG + Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1092023490 12:5222049-5222071 GAGTGGATAAAGCACCAGGGGGG + Intergenic
1092205974 12:6614269-6614291 CAATGGAGAAAGGGCAAGGGAGG - Intergenic
1092880959 12:12887614-12887636 CAGAGGATAAAGATCGAGTATGG + Intergenic
1097665682 12:62474848-62474870 CAGTGAATAAAGAGAGATGAGGG - Intronic
1098529843 12:71529343-71529365 CAGGAGAGAGAGAGCGAGGGGGG + Intronic
1098632499 12:72741026-72741048 TAGTGAACAAAGAGGGAGGGTGG - Intergenic
1099034871 12:77573727-77573749 GGGTGGGTAAAGAGGGAGGGAGG + Intergenic
1101786321 12:107886704-107886726 ATGTGGATAAAGTGGGAGGGAGG + Intergenic
1102194725 12:111016900-111016922 CAGAGGTAAAAGAGAGAGGGAGG - Intergenic
1102393294 12:112567077-112567099 CAGGAGAGAAAGAGCGAGGAGGG - Intergenic
1103640911 12:122351520-122351542 CAGTTAACAAAGAGCAAGGGGGG - Intronic
1108889682 13:55239656-55239678 AAGTGGAGAAAAAGAGAGGGAGG + Intergenic
1110347850 13:74468833-74468855 CAGAGAATAAAGACCCAGGGTGG + Intergenic
1110619006 13:77574272-77574294 CAGTGCATAAATTGTGAGGGAGG - Intronic
1112709146 13:102106569-102106591 CTGTCGAAAAAGAGGGAGGGAGG + Intronic
1113280981 13:108787164-108787186 CAGTAAATAAAGAGTGTGGGAGG + Intronic
1113596197 13:111535292-111535314 GAGTGGATAAAGAAGGTGGGCGG - Intergenic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1114558940 14:23577625-23577647 CTGCGGAGAAAGAGGGAGGGGGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1117063221 14:51983612-51983634 ACCTGGGTAAAGAGCGAGGGTGG - Intergenic
1118915660 14:70101344-70101366 CAGTGGATAAAGAAAGAGAATGG + Intronic
1122448021 14:101782541-101782563 AAGGGGAGAAAGAGAGAGGGAGG - Intronic
1124843367 15:33265455-33265477 CAATGAATAAAGAGGGTGGGAGG - Intergenic
1125510414 15:40289675-40289697 CAGGGGATGAAGAGGGAGTGAGG - Intronic
1128005313 15:64234205-64234227 CACTGGGTAAAGGGTGAGGGGGG - Intronic
1130844729 15:87734143-87734165 GAGTGGATGAAGAGGGATGGAGG + Intergenic
1130899274 15:88194827-88194849 AAGTGAATAAAGAGAGAGGGAGG - Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1136074819 16:27809788-27809810 CAGTGGAAAGACAGGGAGGGTGG - Intronic
1138956439 16:61976385-61976407 CAGTCGAGAAAGAGAGAGGGAGG - Intronic
1140978040 16:80079680-80079702 AAGTAGAGAAAGAGGGAGGGGGG - Intergenic
1141261542 16:82458881-82458903 AACTGGACAAAGAGTGAGGGTGG + Intergenic
1141848757 16:86629819-86629841 CAGGGGACAAAGAGTGATGGTGG + Intergenic
1143734303 17:8899676-8899698 AAGTGGAGAAAGAGCTAGGATGG - Intronic
1146175476 17:30663650-30663672 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146348927 17:32079696-32079718 CTGTGGATAAGGATGGAGGGAGG - Intergenic
1146401717 17:32504921-32504943 CAGTGGAGAAGGAGCGGGAGCGG - Intronic
1146459963 17:33038579-33038601 CAGTGGAGAAAGAGTGGGGGAGG - Intronic
1146798509 17:35800036-35800058 CAGTGCAGAGAGAGGGAGGGAGG - Intronic
1147317185 17:39626692-39626714 GAGAGGATAAAGGGGGAGGGAGG - Intergenic
1148081327 17:44968819-44968841 CAGGGGACAAAGAGCGATTGAGG + Intergenic
1149587319 17:57800652-57800674 CAGAAGGTAAAGAGGGAGGGAGG - Intergenic
1150326417 17:64262279-64262301 CTCTGGAGAAAGAGCGAGGGTGG + Intronic
1162119917 19:8458161-8458183 AAGAGGATCAAGAGTGAGGGAGG - Intronic
1162983490 19:14254261-14254283 CTGTGGATAAGGATGGAGGGAGG + Intergenic
1163445943 19:17346594-17346616 CAGTGGACACAGAGCCTGGGAGG + Intergenic
1165332958 19:35151492-35151514 CAGTGGGCAAAGAGCGGGAGGGG + Intronic
1166872734 19:45880740-45880762 AAGGGGATAAAGAGTGATGGGGG - Intergenic
1167751326 19:51382080-51382102 CAGTGGATCAAAAGCATGGGTGG + Intronic
926158861 2:10474240-10474262 CAGGTGACAAAGAGCCAGGGAGG + Intergenic
926452626 2:13024126-13024148 CAATGGAAAGAGAGGGAGGGAGG + Intergenic
928899829 2:36304972-36304994 CATGGGAGGAAGAGCGAGGGAGG - Intergenic
930216150 2:48699406-48699428 AAGTGGAGGAAGAGAGAGGGTGG - Intronic
931690806 2:64833498-64833520 CAGTTGAGAAAGAGAGAGGGAGG + Intergenic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
938826819 2:135013857-135013879 CAGAGGATCAAGAGAGAGGAGGG - Intronic
939570487 2:143834358-143834380 CAGTGAATAAGGAGAGAGCGAGG - Intergenic
943722943 2:191223687-191223709 CCATGGAAAAAGAGAGAGGGAGG + Intergenic
944455315 2:199887583-199887605 CAGTGGATGAAAGGGGAGGGAGG + Intergenic
944945433 2:204678501-204678523 CAGTGGAAAAGGAGCTAGAGCGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
947633226 2:231666757-231666779 CAGGGGACAAAGAGCCAGGTGGG - Intergenic
1173370364 20:42429494-42429516 CAGGGGATGAGGAGAGAGGGAGG - Intronic
1173398367 20:42702040-42702062 AAGTGGGTAAACAGAGAGGGAGG - Intronic
1173578066 20:44126125-44126147 CAGAAGAAAAAGAGAGAGGGAGG + Intronic
1174931858 20:54824832-54824854 CAGTGGGTAAAGAGAGAGAGAGG + Intergenic
1175313278 20:58026512-58026534 TTGTGGATAAAAAACGAGGGAGG + Intergenic
1177319449 21:19501142-19501164 CAAAGGAGAAAGAGAGAGGGGGG + Intergenic
1183055084 22:35300198-35300220 CAGTAGGTAAGGAGAGAGGGTGG + Intronic
1183623139 22:38986492-38986514 CAGTGGGTCAAGAGGGAGGGCGG - Intronic
1184989278 22:48156220-48156242 CAGTGGGTAGGGAGAGAGGGAGG - Intergenic
1185191394 22:49438703-49438725 CAGAAGATGAAGGGCGAGGGAGG - Intronic
1185416365 22:50712521-50712543 CAGTGGGTCGAGAGAGAGGGAGG - Intergenic
954376540 3:50196832-50196854 CAGTGGAGCAAGAGCAGGGGAGG + Intergenic
954553674 3:51502363-51502385 CAGTGGAGCAAGGGTGAGGGTGG - Intergenic
958038093 3:88193434-88193456 TTGTGGATAAATTGCGAGGGAGG - Intergenic
959783464 3:110264906-110264928 AAGTGGAGAGAGAGAGAGGGAGG - Intergenic
961254207 3:125533215-125533237 CAGAAGAGAAAGAGGGAGGGAGG - Intronic
962823247 3:139073561-139073583 GAATGGATAAAGAGGGAGGGGGG + Intronic
964632999 3:158833022-158833044 CAGTGGATAGAGTGGGTGGGAGG + Intergenic
964993158 3:162840622-162840644 GAGTGGATAAAGAGCATGTGTGG + Intergenic
965345056 3:167538084-167538106 GAGTGGATAGAGAGAAAGGGAGG - Intronic
966288158 3:178321899-178321921 CAGTGAAGAAAGTGCTAGGGAGG + Intergenic
967126526 3:186429493-186429515 CAGTGATTTAAGAGCTAGGGAGG - Intergenic
969261365 4:6036180-6036202 CAGTGGAGGCAGAGCCAGGGAGG + Intronic
970095639 4:12460320-12460342 CAATGGATAAAGAGTGAGAAAGG - Intergenic
972831326 4:42817012-42817034 AAGTGAATAAAGAGGGAGGCAGG + Intergenic
973661523 4:53112063-53112085 CTGTGGATACAGAGCTAGGCCGG + Intronic
974020434 4:56687951-56687973 AGGTGGATAGAGAGGGAGGGAGG + Intergenic
974622580 4:64379903-64379925 CATTGGATAAATACCCAGGGTGG + Intronic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975738005 4:77400498-77400520 GAGGGGATAAAGAGTGAGGCAGG + Intronic
981413395 4:144459066-144459088 CAGTGGATCCAGAGAGAGTGTGG + Intergenic
982049678 4:151488317-151488339 GAGTGGAGAGAGAGTGAGGGGGG - Intronic
982602248 4:157467476-157467498 CAATGGGAAAAGAGAGAGGGAGG - Intergenic
986014812 5:3748564-3748586 CAGGGGAGAGAGAGGGAGGGCGG - Intergenic
988101101 5:26680005-26680027 AAGAGGAGAAAGAGGGAGGGAGG - Intergenic
990350294 5:54909128-54909150 CAGGGGAAAAAGAGCCAGTGAGG - Intergenic
990389861 5:55307789-55307811 CAGTGGATAAAGAGCGAGGGCGG - Exonic
990522787 5:56595775-56595797 CAGTGGTTGAAGAGTGAAGGAGG - Intronic
991442471 5:66665284-66665306 CAGTGGAACAAGAGAGAGTGGGG + Intronic
992192237 5:74304557-74304579 CAGTGGAGAAAGAGGAAAGGAGG + Intergenic
992945160 5:81802614-81802636 GAGTGGAGAAAGAGAGAGAGAGG + Intergenic
994925218 5:106108570-106108592 CAGTGGATACAGAGAGATGCAGG - Intergenic
995845956 5:116494061-116494083 CACAGGATAAAGAGAGAGAGAGG - Intronic
998870993 5:146551485-146551507 AACTGGATAGAGAGGGAGGGAGG + Intergenic
1000175231 5:158745717-158745739 TAGAGGATAAAGAGGGAGGGTGG + Intronic
1002533770 5:179864890-179864912 CAGTGAATGAAGAGCGGGTGTGG + Intronic
1005409880 6:25533193-25533215 CAGTAGATAAAGAGGGACAGAGG - Intronic
1011447742 6:87460626-87460648 CAGTGGAAAGAGTGGGAGGGGGG + Intronic
1015765669 6:136713340-136713362 CAGTGGGCAAGGAGTGAGGGTGG + Intronic
1019721231 7:2572838-2572860 ACGTGGATAAAGAGAGAGGCCGG - Intronic
1022103785 7:27184503-27184525 CAGAGGAGAAAGAGCGGCGGCGG - Exonic
1023195029 7:37627247-37627269 CAGTGGTTAAGGAGGGAGTGAGG - Intergenic
1023624700 7:42104401-42104423 CAGTGGGTAAACAGGCAGGGCGG + Intronic
1024309471 7:47956264-47956286 CAGTGGGAAAAGAGAGCGGGAGG + Intronic
1027234022 7:76287222-76287244 CTGCGGAGAAAGAGGGAGGGGGG - Exonic
1027689490 7:81325051-81325073 CAGAGGATCAGGAGCCAGGGGGG - Intergenic
1029524276 7:101085632-101085654 GAGTGGAGAGAGAGCGCGGGAGG + Intronic
1035041299 7:155929651-155929673 CACTGGATGAGGAGGGAGGGAGG + Intergenic
1037868869 8:22472455-22472477 CAGTGGATAAAGATGTAGGGGGG - Intronic
1038263762 8:26020566-26020588 CAATGGATAGAAAGCAAGGGAGG + Intronic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1038922466 8:32099910-32099932 CAGTGGATGAAGGTGGAGGGGGG + Intronic
1039099002 8:33920849-33920871 AAGTGGAAACAGAGAGAGGGAGG + Intergenic
1040091434 8:43402584-43402606 CAGTGGCAAGAGAGTGAGGGGGG + Intergenic
1041272791 8:56125276-56125298 CTTTGGATAAATAGCGAGTGTGG + Intergenic
1043918685 8:85955259-85955281 GAGTGGAGAAGGAGGGAGGGGGG + Intergenic
1044113819 8:88309417-88309439 AAGTCTATAAAGAGGGAGGGTGG + Intronic
1049123946 8:140768528-140768550 CAGTGGAAAAAGGGCAAGGCTGG + Intronic
1050162702 9:2734617-2734639 CAGTGGATAGAGAGAGGGTGAGG - Intronic
1051664327 9:19454464-19454486 CAAGGGATAAAGAGCCAGGAAGG - Intergenic
1056816012 9:89801561-89801583 CACTGGTTAAAGAGCAAGTGGGG - Intergenic
1057333207 9:94135561-94135583 CAGAGGAGAAAGACAGAGGGAGG - Intergenic
1060003202 9:119977147-119977169 CAGTGTGTAAAGAGTGAGAGAGG - Intergenic
1060123708 9:121021174-121021196 CAGGGGATTAAAAGTGAGGGGGG + Intronic
1060231427 9:121828113-121828135 CTGTGGACAAAGAGTAAGGGTGG - Intronic
1061921844 9:133786914-133786936 AAGGGGAGAAAGAGGGAGGGAGG + Intronic
1186040359 X:5470427-5470449 CAGAGGATAAAGACAGAGAGGGG + Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1188695149 X:33180880-33180902 CAGTGGAGAAAGGGTGAGAGAGG + Intronic
1189900363 X:45700173-45700195 CAGTGGATAAGGAAAGAGGGTGG + Intergenic
1190540370 X:51471297-51471319 CAGTGGAAAAAGAGCCTGAGAGG - Intergenic
1191712012 X:64159936-64159958 TAGTGGCTAAGGAGGGAGGGAGG + Intergenic
1194566844 X:95499563-95499585 AAGAGGAGAAGGAGCGAGGGTGG - Intergenic
1198173950 X:134136082-134136104 CAGGAGAGAAAGAGTGAGGGGGG - Intergenic
1201509591 Y:14744245-14744267 CAGAAGATAAAGAGTGAGGATGG + Intronic