ID: 990391066

View in Genome Browser
Species Human (GRCh38)
Location 5:55321558-55321580
Sequence GGTCAGATTGAATTCCCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990391066 Original CRISPR GGTCAGATTGAATTCCCCTA TGG Intronic
908525415 1:64983289-64983311 GGAAAGATTCAATCCCCCTAAGG + Intergenic
912445753 1:109734861-109734883 GGCCAGATTGCCATCCCCTATGG - Exonic
912939628 1:114033449-114033471 GGTCAGCTTCCATTCCACTAGGG + Intergenic
918569249 1:185969141-185969163 GGTCAGATTGCATCCTCCTGTGG + Intronic
924837846 1:247672409-247672431 GGTAAGAATAAAGTCCCCTATGG + Exonic
1063506272 10:6603034-6603056 TGTCAGAGGGAATTCCCCTCTGG + Intergenic
1065428850 10:25633246-25633268 GGTCAGATTTAACACCCCTAGGG + Intergenic
1065628882 10:27657797-27657819 GGTCAGATTGCATCTCCCAACGG - Intergenic
1068775180 10:60861314-60861336 GGTCAAATGGAATTTCTCTAGGG + Intergenic
1070580866 10:77718372-77718394 GGTCAGATTGAACACAGCTAAGG + Intergenic
1071996936 10:91158741-91158763 GGTCCCAGTGAATCCCCCTAAGG + Intergenic
1080667272 11:34346681-34346703 GGTCAGACTAGATTCCCCAAGGG - Intronic
1082913795 11:58408368-58408390 AGTCAGATTGAATTGTTCTATGG + Intergenic
1086403265 11:86478474-86478496 GGTCAGAGTAGATTTCCCTAGGG + Intronic
1086854078 11:91845725-91845747 GGGAAGATTGAATTCCTTTAGGG - Intergenic
1088677868 11:112213777-112213799 TGTCAGTTTGAATGCCCCTGAGG + Exonic
1089776119 11:120837352-120837374 GGTCACACTAAATTCCTCTAAGG - Intronic
1090178460 11:124673172-124673194 AGTAAAATTTAATTCCCCTAAGG + Intronic
1091690220 12:2591085-2591107 GGTCAGCTCTAATTACCCTAGGG + Intronic
1092766974 12:11861673-11861695 GATCAGATGGCATTTCCCTAGGG - Intronic
1107315141 13:39122979-39123001 GTTCTGATTAACTTCCCCTATGG + Intergenic
1108222781 13:48254313-48254335 AGTCAGCTTGGACTCCCCTATGG + Intronic
1112715766 13:102183218-102183240 GTTCAGAATTTATTCCCCTAAGG + Intronic
1114031727 14:18585131-18585153 TCTAAGACTGAATTCCCCTAGGG - Intergenic
1114085666 14:19235408-19235430 CCTAAGACTGAATTCCCCTAGGG + Intergenic
1115004215 14:28461706-28461728 GGCAAGAAAGAATTCCCCTACGG + Intergenic
1119639651 14:76305128-76305150 GGGCAGATTGATGTCCCCAAAGG - Intergenic
1121497698 14:94407325-94407347 AGTCAGCTTGAAATCCCTTAAGG - Intergenic
1126698229 15:51343367-51343389 GGCGAGAATGAATTCCCCTAAGG - Intronic
1129652956 15:77504555-77504577 TGTCAGGTTGATTTCCCCAACGG - Intergenic
1130784319 15:87079154-87079176 AGGCAAACTGAATTCCCCTAGGG + Intergenic
1133967235 16:10540202-10540224 GCTCAGTTTAAATTCCTCTAAGG + Intronic
1140678841 16:77363931-77363953 TGTCTGATTGATTCCCCCTAAGG - Intronic
1146197479 17:30825458-30825480 GGTCTTAGTAAATTCCCCTAAGG - Intergenic
1149865115 17:60147262-60147284 GGTCAGATTTAATCCAGCTAAGG + Intergenic
1150861666 17:68806939-68806961 GGTCTGATTGGAGTCCACTAGGG - Intergenic
1157139872 18:45094966-45094988 GGCCAGAGTGAGTTCCCCAAGGG - Intergenic
1167531721 19:50021894-50021916 GGTAAGAATGATTTCCCCTTTGG + Intronic
928632455 2:33208021-33208043 AATCAGAATGAAGTCCCCTATGG - Intronic
932671371 2:73740483-73740505 GGTCAGAGTGAAGTCCCATGGGG + Intergenic
938491092 2:131761676-131761698 ACTAAGACTGAATTCCCCTAGGG - Intronic
938496472 2:131800661-131800683 ACTAAGACTGAATTCCCCTAGGG + Intronic
938965673 2:136386337-136386359 GGTCTGATTGATTCCCTCTAGGG - Intergenic
944648749 2:201807538-201807560 GGGCAGCTTGAAGTCCCCTGGGG - Exonic
946796365 2:223358476-223358498 AGTCAGATTGAATTTCACTCTGG + Intergenic
948565528 2:238883993-238884015 GGTTAATCTGAATTCCCCTAGGG + Intronic
1170610085 20:17905923-17905945 GGTCAGAATGAAGTCCTCTGGGG + Intergenic
1176708227 21:10130536-10130558 CCTAAGACTGAATTCCCCTAGGG - Intergenic
1180035826 21:45248682-45248704 GGTCAGATTCAATTCCAGAAAGG - Intergenic
1180292307 22:10857785-10857807 CCTAAGACTGAATTCCCCTAGGG - Intergenic
1180455839 22:15512188-15512210 TCTAAGACTGAATTCCCCTAGGG - Intergenic
1180495113 22:15887207-15887229 CCTAAGACTGAATTCCCCTAGGG - Intergenic
1181128753 22:20717248-20717270 GCTCAGCTTGAATTCCCATGTGG + Intronic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
951729701 3:25796967-25796989 CGTCTGATTGTATTCCCTTATGG - Intergenic
952187629 3:30987530-30987552 GGTGAGATTCAATTCACCTGAGG - Intergenic
956704349 3:71986448-71986470 GGGCAGATATGATTCCCCTAAGG - Intergenic
957407640 3:79791727-79791749 TGTCAGGTTGAATTTCCGTATGG + Intergenic
972750969 4:41988602-41988624 GGTCAAAGGAAATTCCCCTAAGG + Intergenic
972792437 4:42386019-42386041 GGTCAGATTGAAATACACTTAGG - Intergenic
976658446 4:87513749-87513771 GGGAAGCTTGAAATCCCCTAGGG - Intronic
990391066 5:55321558-55321580 GGTCAGATTGAATTCCCCTATGG + Intronic
995490793 5:112689855-112689877 AGTTAAATTGAATTCCACTATGG - Intergenic
999873473 5:155776245-155776267 GGCCAGACTGAGTCCCCCTAAGG - Intergenic
1004148990 6:13097155-13097177 GGTCAGTTTGAATTCCCTTGAGG + Intronic
1011679853 6:89772545-89772567 GGGCAGATTTATTTCCTCTAGGG + Intronic
1030804875 7:113903954-113903976 GGTCAAATTCAATTCCTCTGTGG + Intronic
1036135729 8:6159782-6159804 GGTAATAACGAATTCCCCTAAGG + Intergenic
1037374000 8:18209094-18209116 GGTCAGGTGGAATTACCCTTAGG - Intronic
1044389361 8:91631005-91631027 GGTCAGAATTATTTCCCCTGTGG - Intergenic
1044770686 8:95628275-95628297 GGGCAGTTTTATTTCCCCTATGG + Intergenic
1045521192 8:102904672-102904694 GGTCTGAATGAGTTCCCCTGGGG - Intronic
1053645189 9:40116050-40116072 CCTAAGACTGAATTCCCCTAGGG - Intergenic
1053760527 9:41347478-41347500 CCTAAGACTGAATTCCCCTAGGG + Intergenic
1054326212 9:63713948-63713970 CCTAAGACTGAATTCCCCTAGGG - Intergenic
1054539382 9:66259921-66259943 CCTAAGACTGAATTCCCCTAGGG + Intergenic
1056216093 9:84407500-84407522 GGACATAGTGATTTCCCCTAAGG - Intergenic
1202792988 9_KI270719v1_random:99505-99527 CCTAAGACTGAATTCCCCTAGGG - Intergenic
1188605353 X:32022382-32022404 GGTCAGATTGAGTTCCACAAAGG - Intronic
1201150304 Y:11091962-11091984 TCTAAGACTGAATTCCCCTAGGG + Intergenic