ID: 990396517

View in Genome Browser
Species Human (GRCh38)
Location 5:55385477-55385499
Sequence CTTTCCAAGCAAGAGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990396511_990396517 -9 Left 990396511 5:55385463-55385485 CCCTCCTAAAAGCCCTTTCCAAG 0: 1
1: 0
2: 0
3: 21
4: 210
Right 990396517 5:55385477-55385499 CTTTCCAAGCAAGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 176
990396509_990396517 -4 Left 990396509 5:55385458-55385480 CCTGCCCCTCCTAAAAGCCCTTT 0: 1
1: 0
2: 1
3: 17
4: 196
Right 990396517 5:55385477-55385499 CTTTCCAAGCAAGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 176
990396510_990396517 -8 Left 990396510 5:55385462-55385484 CCCCTCCTAAAAGCCCTTTCCAA 0: 1
1: 0
2: 0
3: 18
4: 247
Right 990396517 5:55385477-55385499 CTTTCCAAGCAAGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 176
990396512_990396517 -10 Left 990396512 5:55385464-55385486 CCTCCTAAAAGCCCTTTCCAAGC 0: 1
1: 0
2: 0
3: 13
4: 144
Right 990396517 5:55385477-55385499 CTTTCCAAGCAAGAGCTGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990396517 Original CRISPR CTTTCCAAGCAAGAGCTGCA GGG Intronic
900429840 1:2596347-2596369 CTTTCCCAGCTGGACCTGCAGGG + Intronic
901465717 1:9419766-9419788 CTTTACAAGCACGAGCTCAAAGG - Intergenic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
903363915 1:22794305-22794327 CTTTCCTATCAAGCGATGCAAGG + Intronic
904334503 1:29787904-29787926 CTTTCCCAGTGAGAGCTACAGGG - Intergenic
906617397 1:47243130-47243152 TTGTCCAAGGAAGAGCTACACGG - Intergenic
906677770 1:47705664-47705686 CTTTCCAAGCTGGGGGTGCAGGG + Intergenic
907085636 1:51670877-51670899 CATTTCAAGAAAGAGCTGCTGGG + Intronic
909540998 1:76791328-76791350 TTTTCAAAGCAGGGGCTGCAGGG - Intergenic
912259793 1:108098994-108099016 CTTTCCACCCAAGAGATGCTGGG + Intergenic
913448015 1:118970519-118970541 CTTTCCAAGCAGCAGCAGGAAGG + Intronic
914169752 1:145212360-145212382 CTTTCCAAGAATGAGATACACGG - Intergenic
914524867 1:148456322-148456344 CTTTCCAAGAATGAGATACACGG - Intergenic
914598809 1:149179511-149179533 CTTTCCAAGAATGAGATACACGG + Intergenic
914641535 1:149610812-149610834 CTTTCCAAGAATGAGATACACGG + Intergenic
917593654 1:176504766-176504788 CTTTCAAGGCAAAAGTTGCAAGG + Intronic
919801847 1:201359099-201359121 ATTTCCAAACAGGAGCTGCCTGG + Exonic
920186545 1:204162805-204162827 CTCTCCAAGGACGAGGTGCATGG - Intronic
921691847 1:218160674-218160696 GTTTCAAAGAAAGAGCTGAAAGG + Intergenic
922021145 1:221706028-221706050 ATATCAAAGCAAGAGCTGGAGGG + Intronic
923986915 1:239391862-239391884 CTTTCCAAGCCTGCTCTGCATGG + Intronic
924826879 1:247549048-247549070 CTTGCCAACCACGAGCTGCCAGG - Intronic
1062958171 10:1553868-1553890 CTTTACAGGCCAGAGGTGCAGGG - Intronic
1064272393 10:13877539-13877561 CATTCCAATACAGAGCTGCAGGG + Intronic
1064742225 10:18445560-18445582 CTCTCTAAGCAAGATGTGCATGG + Intronic
1065879493 10:30026884-30026906 CCTTGCAAGCCAGGGCTGCAAGG - Exonic
1067655711 10:48189795-48189817 ATTTCCAAGCAAGGGCACCAGGG - Intronic
1067926450 10:50513313-50513335 CTTTCCAAACTGGAGCTGAAAGG - Intronic
1069811441 10:71162951-71162973 CTTTGCAAGCAAGCCCAGCATGG + Intergenic
1072671561 10:97433668-97433690 AGCACCAAGCAAGAGCTGCAGGG - Intergenic
1073458908 10:103654258-103654280 CTGCCCAAGCAAGAACTCCAGGG + Intronic
1074578477 10:114693541-114693563 CTGTGCGAGGAAGAGCTGCAGGG - Intergenic
1077467627 11:2741082-2741104 GTGTCCAAGCAGGGGCTGCAGGG - Intronic
1083266266 11:61548291-61548313 CTTTCCAAGGTGGAGCTGCTGGG + Intronic
1084180870 11:67445198-67445220 CTTTCCCAGAAAGAGATGGATGG + Intergenic
1084564077 11:69919828-69919850 CACTCCAGGCAAGAGCTGGATGG - Intergenic
1090368773 11:126230846-126230868 CTATCAAAACAAGAGCTGCTGGG + Intronic
1091232550 11:133998174-133998196 ATTTCCAAACAAGAACTGCCTGG + Intergenic
1091661274 12:2385554-2385576 ATTTCCAGGCAAAAGCTGCCAGG - Intronic
1095502474 12:42855678-42855700 CTTTACAAGCAAGAGTGGAAGGG - Intergenic
1096775680 12:53962049-53962071 CTTCCCAAGCAAGGGCTGCTGGG - Intergenic
1098384851 12:69907934-69907956 CCTTCCAAGTATGACCTGCAAGG + Intronic
1099781885 12:87205540-87205562 CTCTCCAATCAAAAGCTGAATGG + Intergenic
1102867039 12:116382782-116382804 CTTTCCCAGGAGGAGCAGCAGGG - Intergenic
1105517050 13:21100249-21100271 CTTTCCCAGCTAGGGCTGCTGGG - Intergenic
1106248558 13:27967784-27967806 CATTTCAAGCAAAAGCTGGAAGG - Intronic
1106950985 13:34883614-34883636 CTCTCACAGCAACAGCTGCAGGG - Intergenic
1109189348 13:59306826-59306848 CTTTCAAAGAATGAGCTGCATGG + Intergenic
1115139860 14:30158278-30158300 CTTTTCAAGCTAGAGGTGCTAGG + Intronic
1116897668 14:50333048-50333070 CTATCCAAGAATGAGCTCCATGG - Exonic
1118439357 14:65798826-65798848 CTGTCCATGCGAGAGGTGCATGG + Intergenic
1118858785 14:69645557-69645579 CTTTCCATGGAAGAGGTGGAGGG + Intronic
1121002031 14:90458226-90458248 CTTTTCAAGCAAAAGGTGAAGGG + Intergenic
1121845711 14:97170277-97170299 CATTCCAAACAGGAGCTGCAGGG + Intergenic
1122156170 14:99751742-99751764 CTTTTCAAGGAAGAGCAGCAAGG + Intronic
1122394283 14:101411771-101411793 CTCTCCAAGCAGGAGCTGGTTGG + Intergenic
1123018666 14:105387380-105387402 CTTTCCACCCATGCGCTGCACGG - Intronic
1124088829 15:26578703-26578725 CTTTCTAGGCAAAGGCTGCATGG + Intronic
1124439702 15:29677070-29677092 CTTTGCAGGCAAGAGCTGGGAGG - Intergenic
1124592786 15:31068170-31068192 ATGTCCAAGCAAGAACTGCCTGG + Intronic
1125338419 15:38651245-38651267 ATTTCCTAGGAAGAGCTCCATGG + Intergenic
1126355709 15:47793768-47793790 CATTCTAAGCAAGAATTGCAAGG - Intergenic
1127226793 15:56939718-56939740 CTTTCCTAGCACAAGCTGCATGG + Intronic
1127539255 15:59920969-59920991 CTTTCAAAGCAACATTTGCAAGG - Intergenic
1127762069 15:62149286-62149308 CTTTCCAATGAAGAGGTGCCTGG + Intergenic
1128444409 15:67744485-67744507 TCTTCCAGACAAGAGCTGCAGGG + Intronic
1128685747 15:69684252-69684274 CTGTCAGAGCAATAGCTGCAAGG - Intergenic
1128819968 15:70643011-70643033 CTTCCCAAACAAGGGCTGCCTGG - Intergenic
1128941177 15:71788893-71788915 CTTACCAAGCAAAAGCTTCTAGG + Intergenic
1130833238 15:87624357-87624379 CTGTCTAAGCAGGAGCTACATGG + Intergenic
1135549932 16:23390131-23390153 CTTTCCAAGCATGAACTGGGAGG - Intronic
1136026168 16:27470358-27470380 ATTTCCAAGCACCATCTGCACGG - Exonic
1138418288 16:56883980-56884002 CTTTCTAGGCCAGAGCTGCTGGG - Intronic
1138628969 16:58278425-58278447 TTCTCAAAGCAAGAGCTGCTGGG + Intronic
1138700398 16:58856716-58856738 CTTTCATAGCAAGAGGTGAAGGG + Intergenic
1140891920 16:79292097-79292119 TTTTCCAAGCAGAAGCTGTAGGG + Intergenic
1141184154 16:81775091-81775113 CTTTACATGCATGAGTTGCATGG - Intronic
1144347694 17:14364721-14364743 CTTTGCAAGCAATAGCTACATGG + Intergenic
1147114258 17:38287060-38287082 GTTTCCAGGCTAGCGCTGCAGGG - Intergenic
1147420426 17:40319688-40319710 ATTTCCTAGCAAGACCTGGAAGG - Intronic
1147875098 17:43615403-43615425 CTTTCAAATCTAGAGCTGGAGGG + Intergenic
1148415348 17:47502130-47502152 GTTTCCAGGCTAGCGCTGCAGGG + Intergenic
1148570753 17:48666916-48666938 CTGGAGAAGCAAGAGCTGCATGG - Intergenic
1149261899 17:54889037-54889059 TTTTCCAAGTATGACCTGCAGGG + Intergenic
1152649032 17:81483475-81483497 CTGCCCAAGCAAGGGCCGCAGGG + Intergenic
1156254349 18:35380711-35380733 GTTTCCAAGCAAGTGGTGGATGG + Intergenic
1158675783 18:59516889-59516911 TTTTCCAAGGAAGAGCTGAGTGG - Intronic
1163309012 19:16501347-16501369 CTTTCCCAGCAGGTGCTTCAGGG - Exonic
1163745605 19:19044715-19044737 CTGTCCAAACAACACCTGCAAGG + Intronic
1167292597 19:48632593-48632615 CTTCCCTAGCAAGAGTTGCTTGG - Intronic
925027289 2:620133-620155 CTGTCCAAGCAGGAGCTGAAGGG - Intergenic
925570954 2:5312318-5312340 CTTTCCATGCAACATTTGCAAGG + Intergenic
925615651 2:5742374-5742396 TTTGCCAAGCAGGAGCTGCAAGG + Intergenic
929279662 2:40064128-40064150 CTTTCCTTGCAAGAGCTGTTTGG + Intergenic
929600238 2:43200044-43200066 CTTTCCCAGCCACAGCTGGAGGG + Intergenic
932407747 2:71525118-71525140 CTTTACAAGCCACTGCTGCATGG + Intronic
933938874 2:87229064-87229086 CTTTTGGAGCAAGAGCTCCAAGG + Intergenic
935360797 2:102244926-102244948 CCTTCCAAGCCAAAGGTGCATGG + Intergenic
935515988 2:104039541-104039563 GTGTCCAAGCAGAAGCTGCAGGG + Intergenic
936354263 2:111736711-111736733 CTTTTGGAGCAAGAGCTCCAAGG - Intergenic
939455144 2:142424378-142424400 GTTTGCAAGCAAGATTTGCAGGG + Intergenic
941346957 2:164381415-164381437 CTCTCCAGGTAAGAGCAGCAGGG + Intergenic
945147900 2:206758216-206758238 ATGTCCCAGCAGGAGCTGCAAGG + Intronic
945688866 2:213007725-213007747 CTCTCCCAGCAATAGCTGCCTGG - Exonic
946100861 2:217320861-217320883 CTTTCTAAGCAAGTTTTGCAAGG - Intronic
946261193 2:218492657-218492679 ATTTCCAAGGTAGAGCTGAAAGG + Intronic
1170229577 20:14030022-14030044 CTTTGCAAGTAAAATCTGCAAGG - Intronic
1171753191 20:29075839-29075861 CTTACCATGTAAGAACTGCAAGG - Intergenic
1172978216 20:38922002-38922024 CTTCCAAAGCAGGTGCTGCATGG + Exonic
1175188208 20:57194049-57194071 CATCCCCAGCAGGAGCTGCAGGG - Intronic
1179300002 21:40099706-40099728 CTTTCCTAACAAGAGCTGTGAGG + Intronic
1181859305 22:25805851-25805873 CTTTCGAATCAAGAGCTGAGGGG - Intronic
1183238784 22:36640325-36640347 CTTTCAAAGCAAGGGCTGGAGGG + Intronic
949420950 3:3865039-3865061 GTTTCCAAGCAGGAGCTGGGAGG - Intronic
958136965 3:89506589-89506611 TTATACTAGCAAGAGCTGCAGGG - Intergenic
958729547 3:97947076-97947098 CTGTCCAAGCAAGAACAGTAAGG + Intronic
961948857 3:130724015-130724037 CTTTCCTAGAAAGGGTTGCATGG - Intronic
962309018 3:134312907-134312929 GTTTCCAACCCAGAGCCGCAGGG + Intergenic
962346823 3:134624784-134624806 CTTGCCAATGAAGAGCTCCAGGG + Intronic
962467028 3:135670075-135670097 CTTTGTAAGGCAGAGCTGCAGGG + Intergenic
963079881 3:141381417-141381439 CTCTCCAGGAAAGAGCTGGAAGG - Intronic
966160489 3:176962423-176962445 GTTTTCAAGGAAGTGCTGCATGG + Intergenic
968734081 4:2286196-2286218 CTCTCCCAGCATGGGCTGCATGG + Intronic
969634075 4:8355621-8355643 CTTTCCAAGCATGACCTCAAAGG + Intergenic
975148732 4:70998052-70998074 CTTTCCTCACAACAGCTGCAGGG + Exonic
979542970 4:121907425-121907447 CCTTCCAAGAGAGATCTGCAGGG + Exonic
987864916 5:23526096-23526118 CTTTCCCACCAAGTGCTGGATGG - Intronic
987955850 5:24738983-24739005 ATTTCCAAGTAAGTCCTGCAGGG - Intergenic
989354814 5:40531665-40531687 CTTTCCAAGCATAAGCATCAGGG - Intergenic
989983610 5:50670405-50670427 CTTTCCAAGAATGAGATACATGG + Intronic
990396517 5:55385477-55385499 CTTTCCAAGCAAGAGCTGCAGGG + Intronic
991044243 5:62206409-62206431 CATTGGAAGCTAGAGCTGCACGG - Intergenic
991245646 5:64506218-64506240 CTTTCAAAGCCTGCGCTGCAAGG - Intergenic
992926199 5:81590329-81590351 CTTTCCAAGTAAGAGGTAGAAGG + Intronic
993315639 5:86402779-86402801 CTCACCATGCAAGAGCAGCATGG + Intergenic
995061716 5:107817803-107817825 CATTCAATGCTAGAGCTGCAGGG + Intergenic
995185361 5:109265828-109265850 CTTTCCAAGAAAGAGCCTCCAGG - Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
996390214 5:122952228-122952250 CTATCCAAGCAATGTCTGCATGG + Intronic
999259172 5:150227600-150227622 CTTTGCAACCAGGAGCTTCAGGG - Intronic
1000412685 5:160950046-160950068 CTTTCCAAGCCAGCTCTGTATGG - Intergenic
1002284904 5:178155651-178155673 CCTTCCATGTAAGAGCTGAAGGG - Intergenic
1002774930 6:320601-320623 CAGTCCACGCAAGGGCTGCATGG + Intronic
1003428042 6:6010642-6010664 CTTACCAAGCCACAGATGCAAGG - Intergenic
1003722003 6:8714150-8714172 ATATTCAAACAAGAGCTGCAGGG + Intergenic
1003828741 6:9981442-9981464 GTTTGCAAGCAACAGGTGCAGGG + Intronic
1003943030 6:11046883-11046905 TTTTGCAAGCAACAGCCGCAGGG - Intergenic
1004111222 6:12720763-12720785 CATTTTAAGCAAGAGCTCCAGGG + Intronic
1004980767 6:21021034-21021056 TCTTCCAAGCAAGAACTGTATGG + Intronic
1005809966 6:29507952-29507974 TTTTCCAAGCAAGAACTCTAGGG + Intergenic
1006593257 6:35173606-35173628 CTTTCCTGGCAAGACCTGCAGGG - Intergenic
1006937479 6:37728470-37728492 CTTTCCTTGCAAGTGCTGCTGGG + Intergenic
1007168215 6:39843489-39843511 CTTTCCCAGGAAGAGCGGCCTGG - Intronic
1009419796 6:63452936-63452958 CTTTCCAACCAAGTGCTGTTTGG + Intergenic
1010556879 6:77293168-77293190 CTTACAAAGGAAGACCTGCATGG - Intergenic
1012219245 6:96628233-96628255 CTTTCCAGGGAAAAGCTTCAGGG - Intergenic
1013989619 6:116238358-116238380 CTTTCAAGGAAAGAGCTGCAGGG - Intronic
1015854601 6:137610015-137610037 CTTTCCCAACAATAGCTTCATGG - Intergenic
1023610912 7:41969460-41969482 CTTTCTAAGTGAGTGCTGCATGG + Intronic
1025754308 7:64321345-64321367 CCTTCAAAGCAAAAGGTGCATGG - Intronic
1027433875 7:78143098-78143120 CTTTCCAATCAAGGGGTGGAAGG + Intronic
1028684471 7:93576039-93576061 GTTTCCATGGAAGAGCTCCAAGG - Intergenic
1029359149 7:100075616-100075638 CTTTTGAAGGAAGAGCTGAAGGG + Exonic
1032364305 7:131285052-131285074 CTTTTCCAGCAGAAGCTGCAGGG + Intronic
1034961021 7:155364498-155364520 CTGTCCAAGAAAGAGCTGAAGGG + Intronic
1037722972 8:21460258-21460280 CTCTCCAAGCAAGGCCTCCAAGG + Intergenic
1038614614 8:29080946-29080968 CTTTCCAAACTACAGCTGGAGGG + Intronic
1042112571 8:65396248-65396270 ATTTCCAAGAAAGAGCTGACAGG + Intergenic
1045335350 8:101197808-101197830 GTTTCCAAGGAAAAGCTTCAGGG - Intronic
1048362552 8:133710680-133710702 CTTTCCAAGCAGGTCCAGCAGGG - Intergenic
1048963710 8:139600104-139600126 CTTTCCTAACAAGAACTGGATGG - Intergenic
1049081633 8:140447788-140447810 CACTCCTACCAAGAGCTGCAGGG + Intronic
1049361794 8:142215542-142215564 CTGTCCAAGCCAGGGCAGCAGGG + Intronic
1049397054 8:142405763-142405785 CTGTCCAGGCAGGGGCTGCAGGG - Intergenic
1049655078 8:143793701-143793723 CTTTCCTGGCCAGAGCTGCCTGG - Intronic
1051784716 9:20729755-20729777 GTTTCAAAGCTAGAGCTGAAAGG - Intronic
1051925786 9:22323225-22323247 CTTTCCAAGCAGCAGTTGCGGGG - Intergenic
1057247500 9:93469104-93469126 CTTTCTAACCAAGACCTGAAAGG - Intronic
1057836407 9:98448987-98449009 GTTTCCAAGCATGTGCTGAAAGG + Intronic
1059087975 9:111325040-111325062 CTCTCTCAGCAAGATCTGCAAGG + Intergenic
1060204540 9:121674808-121674830 CACTCCAGGCAAGAGGTGCATGG - Intronic
1060234747 9:121854352-121854374 CTCTCCAAGCAAGAGGTGTGTGG + Intronic
1060849731 9:126864390-126864412 CTTTCCAAGCAGGAGAGGAATGG - Intronic
1062365734 9:136208152-136208174 CCCTCCAAGCAAGTGCTCCAGGG - Exonic
1186068802 X:5795203-5795225 CTTTCCAAGCAATTGAAGCAAGG - Intergenic
1186566642 X:10670089-10670111 CTTTCCGAACAAGAATTGCAAGG + Intronic
1191055133 X:56232990-56233012 TTGTCCAAGGAAAAGCTGCAGGG + Intronic
1192206825 X:69101874-69101896 CTTTCCCGGGCAGAGCTGCATGG + Intergenic
1195138737 X:101937195-101937217 CTTTTAAAGCAAGACCTGCATGG - Intergenic
1198982834 X:142418896-142418918 CTTTCCAACCAAGATTTGCCAGG - Intergenic