ID: 990399946

View in Genome Browser
Species Human (GRCh38)
Location 5:55428213-55428235
Sequence GGGGCATCCCAGAATTCTCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 137}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990399946_990399951 11 Left 990399946 5:55428213-55428235 CCGTGAGAATTCTGGGATGCCCC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 990399951 5:55428247-55428269 TGTACCTAACCTTGTGCTCTAGG No data
990399946_990399953 17 Left 990399946 5:55428213-55428235 CCGTGAGAATTCTGGGATGCCCC 0: 1
1: 0
2: 0
3: 9
4: 137
Right 990399953 5:55428253-55428275 TAACCTTGTGCTCTAGGCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990399946 Original CRISPR GGGGCATCCCAGAATTCTCA CGG (reversed) Intronic
900525210 1:3125183-3125205 GAGGAAGCCCAGCATTCTCAAGG - Intronic
902806245 1:18863084-18863106 GGGCCATCCCAGAACCCCCATGG - Intronic
905322029 1:37124667-37124689 GGGAGAACCCAGAACTCTCACGG - Intergenic
910441988 1:87262398-87262420 GGCTCATCCTAGACTTCTCATGG + Intergenic
913692707 1:121294346-121294368 GGGTCTTCCCACAATTCACAGGG - Intronic
914144849 1:144985744-144985766 GGGTCTTCCCACAATTCACAGGG + Intronic
917931275 1:179824422-179824444 GAGGCAACCCTGAACTCTCAGGG + Intergenic
919263919 1:195237433-195237455 CAGGCATCCCTGTATTCTCAGGG + Intergenic
919843935 1:201629167-201629189 CGGGCATCCCAGTATCCTCTGGG + Intronic
920029881 1:203030444-203030466 GGGTGACCCCAGAAATCTCATGG + Intronic
920480028 1:206312707-206312729 GGGTCTTCCCACAATTCACAGGG - Intronic
920647101 1:207811794-207811816 GGGGCCTCCCTGAATGTTCATGG - Intergenic
922905476 1:229170507-229170529 GGGGCATCCCAGACTTCCTTTGG + Intergenic
1065603343 10:27391964-27391986 GGGGCATCTCATTATTCCCAGGG + Intergenic
1070281360 10:75051144-75051166 GGGTCATGATAGAATTCTCATGG + Intronic
1070285095 10:75077195-75077217 GGGGCACTCCAGAATTAGCATGG + Intergenic
1071255614 10:83869315-83869337 GGGGCCTACCAGATTCCTCATGG + Intergenic
1071944341 10:90624780-90624802 GGGACATCCCATAATTATAAAGG + Intergenic
1075534791 10:123261690-123261712 GTGGAATCCCAGAATTCTCCTGG - Intergenic
1075653257 10:124143978-124144000 GGGACATCCCAGCATCTTCATGG + Intergenic
1076415258 10:130282257-130282279 AGGTCATCCCTGATTTCTCATGG - Intergenic
1076825180 10:132963594-132963616 GGGGCATCCCAGCCCTCACAGGG + Intergenic
1077889957 11:6411593-6411615 GTGCCATCCCAGAAAGCTCAGGG - Intronic
1081284106 11:41246449-41246471 GGGGCATCTCTGCACTCTCAGGG - Intronic
1081832441 11:46124940-46124962 GTGGCATCCCAGTATTTTGATGG + Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1084411618 11:69009287-69009309 AGGAAATCCCAGAATTTTCAAGG + Intronic
1087295495 11:96368235-96368257 GGGTCACCCAAGAATTCTGATGG - Intronic
1089673595 11:120073957-120073979 GGGACTTCCCTGAAGTCTCAGGG - Intergenic
1095749785 12:45697353-45697375 TGGGCATCCCTGCACTCTCAGGG - Intergenic
1096412218 12:51385488-51385510 AGGGCATCCCAAAAATCTTAGGG - Intronic
1096836271 12:54353315-54353337 GGGGCCTCCCAGCATTCCCTGGG - Intergenic
1097536222 12:60873341-60873363 CGGGCATCTCTGCATTCTCAGGG - Intergenic
1102004487 12:109580611-109580633 GGGGCATTCCAGAATCTTCCAGG + Intronic
1107449908 13:40498855-40498877 GGGGCAAGCCAGAATTCTGAAGG - Intergenic
1109063574 13:57653100-57653122 AGAGCAGCCCAGGATTCTCATGG + Intronic
1111595282 13:90403619-90403641 TGGGCATCCCTGTACTCTCAGGG + Intergenic
1116151351 14:41145711-41145733 TGGGCATCCCTGTGTTCTCAGGG - Intergenic
1116317075 14:43410731-43410753 TGGGCATCCCTGTACTCTCAGGG - Intergenic
1117886032 14:60364105-60364127 AGAGCATCCCAAAGTTCTCATGG + Intergenic
1120856839 14:89219856-89219878 GCTGCATCCCAGCAATCTCAGGG - Intronic
1122254098 14:100464062-100464084 GGGGCATCCCAGGGTTCTGCAGG - Intronic
1130412297 15:83656937-83656959 TGTGCATCACAGAATTCACAGGG - Intronic
1130725400 15:86433620-86433642 AGTGCATGCCAGAGTTCTCATGG - Intronic
1135162464 16:20109375-20109397 GGGGCACCCCAGAAATTGCAAGG + Intergenic
1135641480 16:24123415-24123437 GTGGCATCCCATCATTTTCAGGG - Intronic
1135986709 16:27189518-27189540 AGGGCATCCCTAAGTTCTCAGGG + Intergenic
1136096572 16:27961359-27961381 TGTGCATCCCATAATTCCCAAGG - Intronic
1138107864 16:54299877-54299899 GGGGCCACCCACAATTCTGAGGG + Intergenic
1141763780 16:86045682-86045704 GGTGCATTCTAGAATGCTCATGG - Intergenic
1142864436 17:2782121-2782143 GGGGCATGGCAGAAGACTCAAGG - Intronic
1147212630 17:38880718-38880740 GGTTCATCCCAGAATCCCCACGG - Intronic
1147851979 17:43450747-43450769 GGGCCATCCCAAAATCCTTAAGG + Intergenic
1150510469 17:65747267-65747289 GGGCCAACCCAGAATGCACAAGG - Intronic
1151099322 17:71538422-71538444 TGAGAATCCCAGACTTCTCAAGG - Intergenic
1151975918 17:77483478-77483500 GAGGCAGCCCTGAATCCTCAGGG - Intronic
1152207512 17:78982232-78982254 GGGGCATAAGAGAATTCTTAGGG - Intergenic
1153472987 18:5467930-5467952 TGGGCATCCCTGCACTCTCAGGG + Intronic
1155346050 18:24858064-24858086 GGGGCAATCCAAAATTCACAGGG + Intergenic
1157212501 18:45755782-45755804 GGGGTATCCCAAAATACTCTGGG - Intergenic
1158861680 18:61598586-61598608 GAGGTGTCACAGAATTCTCATGG - Intergenic
1159704970 18:71675101-71675123 TGGGAATCCCTGCATTCTCAAGG - Intergenic
1162966878 19:14160321-14160343 GGGGAATCCCAGGACTGTCAGGG + Intronic
1164384425 19:27760994-27761016 GGGTGATCCCAGCATTCTAATGG - Intergenic
1166947704 19:46407194-46407216 GGGGCCTCCCTGAATGCTCACGG + Intergenic
926006460 2:9376870-9376892 AAGGCATTCCAGAATTCTAATGG - Intronic
926122529 2:10252642-10252664 GGGGCACCCCACAATTCCCATGG + Intergenic
926686469 2:15702192-15702214 TTGGCCTCCCAGAAGTCTCAGGG - Intronic
927175034 2:20399761-20399783 TGGGCATCTGAGACTTCTCAGGG + Intergenic
928182795 2:29081160-29081182 CGGGCATCCCTGTACTCTCAGGG - Intergenic
928427854 2:31193381-31193403 TGGGCATCCCAGCCCTCTCATGG + Intronic
929847247 2:45542366-45542388 TGGGCATCCCTGCACTCTCAGGG - Intronic
929967424 2:46545703-46545725 GTGGCATCTCAGCATTCCCATGG - Intronic
932449182 2:71798815-71798837 GGGGCATTTCAGCAGTCTCAGGG - Intergenic
934619036 2:95792922-95792944 GAGGGAGCCCAGATTTCTCATGG + Intergenic
934641855 2:96031635-96031657 GAGGGAGCCCAGATTTCTCATGG - Intronic
935057826 2:99582674-99582696 GAGGCATTCAGGAATTCTCAAGG + Intronic
937370929 2:121296678-121296700 GGGGCATCCCTGTACTCTCAGGG - Intergenic
943223882 2:185144502-185144524 CAGGCATCCCTGAACTCTCAGGG + Intergenic
943686059 2:190819474-190819496 GGGGCATCACAGAAGACACAAGG - Intergenic
947739083 2:232476749-232476771 TGGGTATCCCAGAAATCCCAGGG + Intergenic
948792714 2:240387551-240387573 GGAGCAGCCCAGAAATCTGAGGG - Intergenic
1169315176 20:4584560-4584582 GGGGCAGACCAGAAGTCTTAAGG + Intergenic
1169552541 20:6715691-6715713 GGTGCAGCCCAGGATTTTCATGG - Intergenic
1170525521 20:17232214-17232236 GGGCCATCTCAGAATTCTGCCGG + Intronic
1171340481 20:24423193-24423215 GGTGCATGCCACAATTCTCTAGG - Intergenic
1171391310 20:24803255-24803277 TGGACATCCCAGCATTCCCATGG - Intergenic
1174513643 20:51074919-51074941 GGGGCATCCCAGAAGCCTCTGGG - Intergenic
1174948776 20:55019908-55019930 AGGGATTCCCTGAATTCTCAAGG - Intergenic
1175246680 20:57586331-57586353 GGGGCAAAGCAGAATTGTCAAGG - Intergenic
1178947279 21:36959111-36959133 TGGGCATCCCTGCACTCTCAGGG + Intronic
1183333884 22:37235823-37235845 GGGTCATCCCTGGAATCTCAGGG + Intronic
1183408882 22:37643472-37643494 GGGGCAACCCAGAGCACTCATGG + Intronic
1185263844 22:49887015-49887037 GGGGCAGCCCAAAAATCTGACGG - Exonic
951718565 3:25674292-25674314 GAGGCATCCCTGTACTCTCAGGG - Intergenic
954442485 3:50529461-50529483 GGGTCATCCCAGCTGTCTCAAGG + Intergenic
957009772 3:74990557-74990579 GGATCATCCCAAAAGTCTCATGG - Intergenic
957646574 3:82938970-82938992 TGGGCATCCCAGCGCTCTCAGGG + Intergenic
961549302 3:127659754-127659776 AGGGCCTCCCAGAATGTTCAGGG - Intronic
963292336 3:143504400-143504422 GGGGAACCCAATAATTCTCATGG + Intronic
963424620 3:145110855-145110877 TGGTCATCCCAGAACTCTGATGG - Intergenic
963607974 3:147429126-147429148 GGGAAATCTCATAATTCTCAGGG + Intronic
965508465 3:169541855-169541877 GTAGCATCTCAGAATTCTGAGGG - Intronic
967710712 3:192704377-192704399 TGGTCATCCAAGACTTCTCATGG - Intronic
968170238 3:196503952-196503974 GAGGCCTCGCAGAAATCTCAGGG - Intergenic
972956219 4:44395489-44395511 GGGTGTTCCCAGAATCCTCATGG - Intronic
977556248 4:98489956-98489978 GGGGAATCCCGTATTTCTCAGGG - Intronic
980480830 4:133385286-133385308 CGGGCATCCCTGCACTCTCAGGG + Intergenic
980866410 4:138558316-138558338 GTGACATACCTGAATTCTCAGGG + Intergenic
983266042 4:165509181-165509203 GGGGGATACCAGAACTCTGAGGG + Intergenic
985090856 4:186361351-186361373 GTGTCATCCCAAAATTCTTATGG - Intergenic
988218540 5:28310989-28311011 TGGGCATCCCTGCATTCTCAGGG + Intergenic
988297643 5:29387051-29387073 GGGGCATTCCAGAATACACATGG - Intergenic
988995401 5:36710073-36710095 GGGGTATCCCAAAATGCTCCAGG + Intergenic
989730555 5:44642273-44642295 TGGGCATCCCTGCACTCTCAGGG - Intergenic
990399946 5:55428213-55428235 GGGGCATCCCAGAATTCTCACGG - Intronic
992158873 5:73981338-73981360 GGTGCAGCCCAGAAATCTCTTGG - Intergenic
992871120 5:81006673-81006695 GGGGGATCCGAGAGGTCTCAAGG - Intronic
993536584 5:89094022-89094044 ATGGCATCTTAGAATTCTCAGGG - Intergenic
996639116 5:125730839-125730861 TGGGCTTCCCAGATTCCTCAGGG - Intergenic
998375155 5:141685803-141685825 GGTGCATACCAGAGTTATCATGG - Intergenic
1000072032 5:157749686-157749708 TGGTCAGACCAGAATTCTCATGG + Intronic
1006513957 6:34535861-34535883 GGGGTATCGCAGAAGTCCCAGGG + Intergenic
1006800665 6:36757688-36757710 GGGGGATCACAGAAGTGTCAGGG + Intronic
1007620047 6:43206459-43206481 AGGGCATCACAGAATTCTGTGGG - Exonic
1008547805 6:52598684-52598706 GGAGCACCCCACAACTCTCAGGG + Intergenic
1013016054 6:106161377-106161399 GGGGCATCATAGAATTCTAGAGG - Intergenic
1013367201 6:109445384-109445406 GGGGGTTCCCAAAATTCTGATGG - Intronic
1013770966 6:113627894-113627916 GGAAGATCCCAGAATTGTCAAGG - Intergenic
1014892158 6:126855890-126855912 ACAGCATCCCAGAGTTCTCATGG + Intergenic
1022288053 7:28974362-28974384 GGGCCATGGCAGAATCCTCACGG + Intergenic
1022508201 7:30919953-30919975 GGCACATTCCAGAATTCCCAGGG + Intronic
1024586565 7:50846968-50846990 GGGGCAATCCAGAATTCTGGTGG - Intergenic
1032515482 7:132503419-132503441 CTGGCATCCCAGAATTCCCCAGG - Intronic
1035986492 8:4438279-4438301 GGGGCTTTCCTGAATGCTCATGG + Intronic
1038555636 8:28511693-28511715 TAGGCATCCCAGATTTCTTAAGG - Intronic
1041801392 8:61804339-61804361 GAGGCATCCCAGGATTCCCCTGG + Intergenic
1042061578 8:64823940-64823962 GAGGCTTTCCAGAATTCTTATGG + Intergenic
1042856522 8:73273269-73273291 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1050941882 9:11471234-11471256 TGGGCATCCCTGCACTCTCAGGG + Intergenic
1053584843 9:39446138-39446160 AGGACATCAGAGAATTCTCATGG - Intergenic
1054581473 9:66919084-66919106 AGGACATCAGAGAATTCTCATGG + Exonic
1055892571 9:81139149-81139171 GGGGGAGCTGAGAATTCTCAGGG - Intergenic
1187124904 X:16445834-16445856 GGGGCATCCCATGATTCTCCAGG + Intergenic
1187633653 X:21203128-21203150 GGGGTATTCCACACTTCTCATGG - Intergenic
1188244254 X:27821472-27821494 GGGGCATCCAACAATCCCCATGG + Exonic
1197007417 X:121518604-121518626 TAGGCATCCCAGAAATGTCAAGG + Intergenic