ID: 990401338

View in Genome Browser
Species Human (GRCh38)
Location 5:55440523-55440545
Sequence ATGTTTCTGCAGATGCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 237}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990401338_990401339 -1 Left 990401338 5:55440523-55440545 CCATGCTGCATCTGCAGAAACAT 0: 1
1: 0
2: 2
3: 25
4: 237
Right 990401339 5:55440545-55440567 TTTGAGTGTGTGTCTTAAAAAGG 0: 1
1: 0
2: 2
3: 48
4: 601

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990401338 Original CRISPR ATGTTTCTGCAGATGCAGCA TGG (reversed) Intronic
901173398 1:7280439-7280461 AGGTTTCTGCAGAAGCAGCTTGG + Intronic
903032086 1:20471284-20471306 ATGTTTCTGCAGCTCATGCAAGG - Intergenic
903338352 1:22639282-22639304 ATGGTGCTTCAGCTGCAGCAGGG + Exonic
905768483 1:40622586-40622608 GTGTTTCTGCAGTGGCTGCAGGG - Exonic
907312298 1:53545866-53545888 ATCTGGCTCCAGATGCAGCAGGG - Intronic
907417991 1:54327594-54327616 ATGATTCTGCAGCTGCTGCTGGG + Intronic
907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG + Intergenic
907843383 1:58178467-58178489 TTGCTTCAGCAGATGCAGAAGGG + Intronic
912903514 1:113678826-113678848 CTCTTTCTACAGATACAGCATGG - Intronic
915985740 1:160462417-160462439 ATGCTTCTGATGAAGCAGCATGG + Intergenic
916518359 1:165541187-165541209 ATGCAGCTTCAGATGCAGCATGG - Intergenic
916866890 1:168869415-168869437 ATGTTTCTGGAGTTGCTGTATGG - Intergenic
918048643 1:180955981-180956003 CTGTTCATGCAGGTGCAGCAGGG - Intergenic
919144976 1:193622543-193622565 ATGTTTCTTCATATGCAACATGG + Intergenic
919766295 1:201129359-201129381 AAGGTTCTGCAGATTCAACAGGG - Intergenic
922886897 1:229027367-229027389 TTGCTTCTGCACCTGCAGCAGGG - Intergenic
923055424 1:230423146-230423168 CTGTTTTTACAGTTGCAGCAAGG + Intronic
923315104 1:232772876-232772898 CTGTTCCTGCACATGCAGCTTGG + Intergenic
924327661 1:242911875-242911897 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1063640311 10:7823248-7823270 AAGATTCTGCAGATGCATCAGGG + Intronic
1065772364 10:29089477-29089499 ATGTTTCTGAACATTCACCATGG + Intergenic
1068727915 10:60323926-60323948 GTGTTCCTGCAAAAGCAGCATGG + Intronic
1069079533 10:64073406-64073428 ATGGTTCTGCAGATAGTGCAGGG + Intergenic
1070270553 10:74950406-74950428 CTGTTACTGCAGATGCAGACGGG + Intronic
1071405777 10:85329828-85329850 CTGTTTCTTCAGATGGAGCCTGG - Intergenic
1072561445 10:96579325-96579347 ACATTTCTGCAGACTCAGCAGGG - Intronic
1075967916 10:126628770-126628792 TGGTTTCTGCAGAAGCTGCAGGG - Intronic
1076002808 10:126925773-126925795 CTATTTCTGCAGATGCACCTAGG - Intronic
1076106473 10:127827475-127827497 AGTTTTCTGCAGATTCAGGAGGG + Intergenic
1077457600 11:2690258-2690280 ACATATGTGCAGATGCAGCAAGG - Intronic
1077835876 11:5928169-5928191 CTGCTTCTGCCGCTGCAGCAGGG + Intronic
1077939685 11:6827847-6827869 ACGTTTCTGCTTAGGCAGCAAGG + Intergenic
1078879110 11:15430500-15430522 AACTTTATGCAGATGCAGCCCGG - Intergenic
1078972944 11:16436169-16436191 ATGTTTCTGCACATGTATCCCGG + Intronic
1079870073 11:25786348-25786370 CTGTTTCTGCAGGGCCAGCAAGG + Intergenic
1080119806 11:28664321-28664343 AAGTTGCTCTAGATGCAGCAGGG + Intergenic
1081632129 11:44696302-44696324 ATGTTTCTCCACCTGCAACACGG + Intergenic
1082803683 11:57432798-57432820 ATGTTCCTCCAGATGCTGCACGG + Intergenic
1083137583 11:60693409-60693431 ATGCTTCTGCAGAGGCCTCAGGG + Intergenic
1083311216 11:61784716-61784738 AGGTGTCTGCAGAAGCAGGAAGG + Intronic
1087596337 11:100258820-100258842 ATGTTTTTGCAGAGGCTGTATGG - Intronic
1087982662 11:104635396-104635418 AAGTTTCTTCAGATGCAAAATGG - Intergenic
1088949777 11:114555819-114555841 ATGTTTTTGAAGATTCATCAAGG + Intronic
1091556300 12:1576125-1576147 AAATTACTGCAGATGAAGCAGGG + Intronic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1092989039 12:13877191-13877213 ATGGTTCTGCTGATGGAACATGG + Intronic
1093193034 12:16097044-16097066 ATGTTTCTTCACATGTAGTAAGG + Intergenic
1094398538 12:30035386-30035408 CAGTTTCTAGAGATGCAGCATGG + Intergenic
1094809319 12:34122465-34122487 AGGTTTCTCCACAGGCAGCAGGG + Intergenic
1095650221 12:44599096-44599118 TTGTTTCCGCAGGTGTAGCAGGG - Intronic
1097332668 12:58349292-58349314 TTGTTTGTGCAGATGCAGTTGGG + Intergenic
1097653260 12:62330230-62330252 ATATTTCTATAGATGAAGCAAGG + Intronic
1097706808 12:62877255-62877277 TTGTGTCCGCAGATGCACCAGGG + Intronic
1098977585 12:76919579-76919601 ATATTTGTGCAGATGTGGCAAGG + Intergenic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100994748 12:100292787-100292809 ATTTTTGGGTAGATGCAGCATGG - Intronic
1102738472 12:115184713-115184735 TGGGTTCTGGAGATGCAGCAGGG - Intergenic
1104533220 12:129592755-129592777 ACGTTTGTGAAGATGGAGCAAGG + Intronic
1105497367 13:20942448-20942470 TGGTTTCTGCAGTGGCAGCAGGG + Intergenic
1106565567 13:30881679-30881701 ATGTCTATGAAGCTGCAGCAAGG - Intergenic
1110328683 13:74246637-74246659 GTGTTTCTGGAGAGGCATCACGG - Intergenic
1111465949 13:88611030-88611052 ATGTTTTTGCAGCTGGAGCAGGG - Intergenic
1113031373 13:105997398-105997420 AGGTTGGTGCAGATGCAGGAAGG - Intergenic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115354712 14:32435037-32435059 ATCTTTCTGCTGTTGCAGCAGGG + Intronic
1119420353 14:74504533-74504555 TTGTTTCTGGAGGTGCAGCTTGG + Intronic
1121241129 14:92430776-92430798 ATGTATCTGCAGGTGGAGCTGGG - Intronic
1121861815 14:97325710-97325732 CTGTTTCTGCAGGTGCTCCATGG + Intergenic
1122834186 14:104423138-104423160 AGGTTTCTGCAGGTCCAGCCGGG - Intergenic
1122931521 14:104934926-104934948 AGCTTGCTGCAGATGCTGCAGGG + Exonic
1124032246 15:26022155-26022177 ATATTTATGCACATGCAGAATGG + Intergenic
1124094704 15:26638253-26638275 ATATCTAGGCAGATGCAGCAGGG + Intronic
1124228292 15:27916580-27916602 ATGTTTCTGCAGATTTAGAAGGG - Intronic
1124254111 15:28127223-28127245 GTGTCTCTGCAGACGCAGCTGGG + Intronic
1126589575 15:50325414-50325436 CTGTTTCTGCTGATGTAGAATGG + Intronic
1128949954 15:71868291-71868313 ATGTCTCTGAAGATGGAGAAAGG - Intronic
1130060437 15:80566025-80566047 ATTTTTCTGCAGATTCTGCATGG + Intronic
1130927587 15:88396952-88396974 ACCTTTCTGGAGATGCAGCTGGG - Intergenic
1132014877 15:98306667-98306689 AAGTTTATGCAGATGCAGTTGGG - Intergenic
1132761324 16:1509881-1509903 GAGTCTCTGCAGAAGCAGCAGGG - Exonic
1133143636 16:3767263-3767285 AGGTTTCTGCAGGTGCAGTGAGG - Intronic
1133253550 16:4501769-4501791 ATGTTTCTGCAGTTGCAAGGTGG + Intronic
1133514264 16:6492655-6492677 AAGTTTGTGAAGATGCAGCTTGG + Intronic
1134916242 16:18073403-18073425 ATGTTGCTGAAGAAGCAGCCAGG + Intergenic
1136461716 16:30415332-30415354 CTGTTTCTGAAGCTGCAGGAGGG - Intronic
1137249157 16:46730117-46730139 ATGTTCCTTCAGGTGCAGGATGG - Intronic
1138236616 16:55388911-55388933 ATTTTTTTCCAGAGGCAGCATGG - Intergenic
1138598339 16:58041266-58041288 AAGTTGCTGGGGATGCAGCAAGG - Intronic
1139010641 16:62628880-62628902 CTGCTTCTGCTGATGCAGGAAGG + Intergenic
1139237279 16:65353058-65353080 ATGCTTCTGCAGAGGAAGTAGGG + Intergenic
1139799184 16:69507486-69507508 GTGTGTCTGCAGAGGCAACATGG - Intergenic
1141082059 16:81061359-81061381 CCGTTTCTGCAGAAGCTGCAAGG + Exonic
1141110564 16:81267747-81267769 AGGTTGCTGCAGCTGCTGCAGGG - Intronic
1141358397 16:83371288-83371310 ATGTGACTGAAGATGCAGGAAGG - Intronic
1141739629 16:85882420-85882442 ATGTTTCTGGAGAAGTGGCAGGG - Intergenic
1141822753 16:86458800-86458822 ATGTTTCTAAAGACACAGCAAGG + Intergenic
1142118651 16:88374986-88375008 CGGTTTCTGCAAATGCAGCTGGG - Intergenic
1143464841 17:7129723-7129745 ATCTTTCTGCACATACAGCCAGG + Intergenic
1144717688 17:17445794-17445816 ATTTTTCTGCAGAGGCAGGCGGG - Intergenic
1144939993 17:18932260-18932282 TTGTTTGTGCAGAAGCACCAAGG + Intergenic
1146283012 17:31557648-31557670 ACGTTGCTGGAGATGCAGCCGGG - Intergenic
1148053165 17:44779205-44779227 ATGTTTCTGCAGGGGGAGGATGG - Exonic
1149192166 17:54076132-54076154 ATGATTCTGCAGATGAATCTGGG + Intergenic
1149543798 17:57488286-57488308 AAGCTTCCGCAGATGCTGCAAGG - Intronic
1153902032 18:9625800-9625822 ATGTTGCTGAAGATGAAGAAAGG - Intergenic
1155089570 18:22493487-22493509 ATGTTTCTGCTTATTCAGCAAGG - Intergenic
1155434554 18:25798082-25798104 AACTGCCTGCAGATGCAGCAAGG - Intergenic
1155517795 18:26640554-26640576 GTGTATGTGCAGATGCATCATGG - Intronic
1156512825 18:37655445-37655467 ATGTGCCTGCACATGCACCATGG + Intergenic
1156535513 18:37860993-37861015 ATGTGGCTGCAGCTACAGCAAGG - Intergenic
1157110777 18:44818238-44818260 ATGTTTTTTCACATGCAGAAAGG + Intronic
1157134261 18:45038624-45038646 ACGTTGCTGCAGATGCAGCAAGG - Exonic
1159021092 18:63143777-63143799 AGGTTTCTGCAATGGCAGCAAGG - Intronic
1160263825 18:77320887-77320909 ATGTTGCTGCCCATGCACCATGG + Intergenic
1160538927 18:79610114-79610136 ATCTAGCAGCAGATGCAGCAGGG - Intergenic
1160563698 18:79774064-79774086 ATGTTTCTGCAGGGGCTGCTGGG + Intergenic
1160874340 19:1290247-1290269 ATGCTTCTGCCGAGGCACCATGG + Intronic
1163718967 19:18889257-18889279 ATGTTTCTGGAGAGTCAGGATGG - Intronic
1164607955 19:29613506-29613528 GTGTTTGTGCAGATCCTGCAAGG + Intronic
925429479 2:3778668-3778690 CAGTTTCTCCAGATGCAGGATGG - Intronic
925434319 2:3823829-3823851 ATGTGTCTGCAGTTACTGCATGG + Intronic
925774640 2:7322718-7322740 ATAATTCAGTAGATGCAGCATGG + Intergenic
927268996 2:21185448-21185470 ATGACTTTGCAGATGCAGCATGG - Intergenic
928977820 2:37107120-37107142 ATCTTTCTGCAGAAACAGAAAGG - Exonic
929283148 2:40105265-40105287 ATGATTCTGCAGAGGCTGCTGGG - Intronic
929360790 2:41087833-41087855 AAGTATCTGAAGATGCAGAAAGG - Intergenic
930107426 2:47651088-47651110 GGGTCTCTGCAGATGCAGTAAGG - Intergenic
930844688 2:55889475-55889497 ATGTTTCTCCATATGCCTCAGGG + Intronic
931642860 2:64396769-64396791 AGGATTCTGCAGATGAGGCAAGG - Intergenic
931889104 2:66650420-66650442 AAGTTACTGTAGATGCAGAAAGG + Intergenic
931964009 2:67513472-67513494 TTGAATCTGCAGATGCAGTACGG - Intergenic
932293895 2:70608552-70608574 CTGTTACTGCAGATTCAGCCAGG - Intronic
933656786 2:84895152-84895174 ATTTGGCGGCAGATGCAGCAAGG - Intronic
934861779 2:97769741-97769763 AGGTTTCTGCAGAACCAGGAAGG - Intronic
934927202 2:98390085-98390107 GTGGTTCTGAACATGCAGCAGGG + Intronic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
935700024 2:105803621-105803643 ATGTCTCTGCACATGATGCAGGG - Intronic
938342729 2:130546302-130546324 ATGATGGTGCAGCTGCAGCAGGG + Exonic
939603263 2:144220367-144220389 AAGTTTCTGCAGAGGAAGCACGG + Intronic
942637003 2:178018326-178018348 ATGTCTATGCAGACGCATCACGG + Intronic
943945838 2:194062592-194062614 TTGTAACTGTAGATGCAGCATGG + Intergenic
944029476 2:195216873-195216895 ATGATTCTGCCGCTGCAGCTTGG - Intergenic
945797386 2:214381811-214381833 ATGTCTCTGCAAATACACCAAGG + Intronic
946952749 2:224895080-224895102 AGGATTCTGGAGAAGCAGCAAGG - Intronic
948877425 2:240837095-240837117 CTGTGTCTGGAGCTGCAGCATGG + Intergenic
1169305990 20:4490843-4490865 CAGTTTCTGCAGCTGGAGCAGGG - Intergenic
1170801638 20:19595287-19595309 TTGGTGCTGCAGATGCAGTAAGG - Intronic
1171235456 20:23520779-23520801 GTGTATCTTCAGAGGCAGCAGGG + Intergenic
1172122583 20:32607642-32607664 ATGTTTCTGCTGTTGCTGCTAGG - Intronic
1173072055 20:39777704-39777726 ATTTTTCTGCAGATGCTGTGGGG + Intergenic
1173583145 20:44161411-44161433 ATGTGTGTGGAGAGGCAGCAGGG + Intronic
1174112001 20:48203577-48203599 GTGTTTGTGCAGATGCACCTCGG - Intergenic
1176089220 20:63311613-63311635 ATGTCTCTGCAGGTGCAGGTCGG + Exonic
1178412064 21:32372611-32372633 AGGTTTCTGCCGAAGAAGCAGGG - Exonic
1179553707 21:42159606-42159628 TTCTTTCTGCAGATGCACGAGGG + Intergenic
1179982717 21:44905023-44905045 ATGTCGCTGCAGACGCCGCACGG - Intronic
1182441758 22:30368721-30368743 AGCTTTTTGCAGATGCAGGAGGG - Intronic
1185109944 22:48895198-48895220 CCGTGTGTGCAGATGCAGCAAGG + Intergenic
950155983 3:10722053-10722075 ATGTTTATGCAGGTGAAGCTAGG + Intergenic
950273635 3:11639899-11639921 ATAATTCTGGAGAGGCAGCACGG + Intronic
950623416 3:14226110-14226132 ATGTTTCTGCAATTGGAGGAGGG - Intergenic
952109965 3:30111063-30111085 ATGTTTTTGCAGTAGCAGGAGGG + Intergenic
952420027 3:33122289-33122311 CTGGTTCTGCAGAAGCAGCGGGG - Intronic
954153377 3:48670973-48670995 AAGTTTCTGAAGCTGCAGCTAGG - Intergenic
954749312 3:52804709-52804731 CTGCATCTGCAGGTGCAGCAAGG - Exonic
956239133 3:67109394-67109416 GTGTTTCTGCAGAAGCAACAAGG + Intergenic
957139164 3:76330519-76330541 ATGTTTCTGTTGAAGCAGAATGG - Intronic
960253184 3:115480367-115480389 ATGTTTCAGAAGATGGAACAAGG + Intergenic
967988845 3:195116203-195116225 ATGTGTCAGTAGATCCAGCATGG - Intronic
968138786 3:196238889-196238911 ATGTTTCTGCAGAAACCGAAAGG + Exonic
968289060 3:197524940-197524962 AAGTCTCTGCAGAGGCACCAGGG + Intronic
970011494 4:11464565-11464587 GAGTTTCTGTAGATTCAGCAGGG + Intergenic
971473829 4:27054004-27054026 ATGTTTTTGCATCTTCAGCAGGG - Intergenic
972025686 4:34373857-34373879 CTGTATCTGCAAAAGCAGCATGG - Intergenic
977009139 4:91613431-91613453 ATGTGTGTGCAGATCCACCATGG - Intergenic
978042769 4:104090694-104090716 ATATTTGTGCAGAAGCTGCAAGG + Intergenic
978593928 4:110356368-110356390 ATGCTGCTGCAGATCCAGCATGG + Intergenic
979547324 4:121952219-121952241 TTGTTTCTGTAGATGCAAAAAGG - Intergenic
979644582 4:123053403-123053425 ATATTTCTGCACAGGCAGGATGG + Intronic
979916833 4:126445721-126445743 ATGTTTCTGTTGTTGCATCATGG - Intergenic
980265217 4:130506255-130506277 ATGTTTCTTCAGTTGAAGGAAGG - Intergenic
981990928 4:150920135-150920157 ATCTTTCTGCAGATACTGCCAGG + Intronic
983643953 4:169970884-169970906 TGGTTTCTGGAGATGCAGGAAGG - Intergenic
985076233 4:186217996-186218018 AAGTTGCTACAGAGGCAGCATGG - Intronic
985420120 4:189776888-189776910 CTGTGACTGCAGGTGCAGCAGGG - Intergenic
986746541 5:10749953-10749975 TCCTTTCTGCAGATGAAGCAGGG - Intronic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
989004602 5:36796430-36796452 CTGTTCCTGAAGATGCTGCAGGG + Intergenic
989022551 5:37026460-37026482 ATATTTCTGGAGATGCTGAAGGG + Intronic
990401338 5:55440523-55440545 ATGTTTCTGCAGATGCAGCATGG - Intronic
992286715 5:75242998-75243020 ATGTTTCTTCAGAAGCAGAAAGG + Intergenic
993425535 5:87759692-87759714 AGCTTGCTGGAGATGCAGCATGG - Intergenic
996005604 5:118417730-118417752 ATGAGTCTGCAGAAGGAGCATGG - Intergenic
998565751 5:143214589-143214611 ATGTGTTTACAGATGCAGCCAGG - Intronic
1000345099 5:160307775-160307797 GGGCTTCTGCAGATGCAGCAGGG + Intronic
1000921442 5:167142927-167142949 ATGTTCCCGCAGATGCTTCAGGG - Intergenic
1001169392 5:169404375-169404397 ATGTTTCTTCACAGGCAGCCAGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001833772 5:174812494-174812516 ATGTTTCTGTTGAGGCACCAGGG - Intergenic
1003475055 6:6473849-6473871 ATATTTTTGAAGATACAGCATGG + Intergenic
1004373401 6:15072144-15072166 ATGTTTCTTCTGGAGCAGCAGGG - Intergenic
1004822421 6:19381991-19382013 ATGTTGGTGGAGATACAGCAGGG - Intergenic
1004969449 6:20892645-20892667 ATGATTCTGTAGATGGAGAAAGG - Intronic
1006807828 6:36799933-36799955 ATGGTGCTGAAGATGCAGCCAGG - Intronic
1006938678 6:37736847-37736869 ATGTATGTGAAAATGCAGCATGG + Intergenic
1009873202 6:69473649-69473671 ATGTGTATGTAGATGCAGCTAGG - Intergenic
1010863947 6:80949152-80949174 ATGTTTCTGCTGATGTATTAGGG + Intergenic
1011458290 6:87576139-87576161 ATCTTTGTGCAGCTGCAGCTTGG - Intronic
1013962582 6:115918319-115918341 ATGTTTCTGTTGGTGTAGCAAGG - Intergenic
1014628993 6:123766465-123766487 ATGTTTCTGGGGAGGCTGCAGGG - Intergenic
1014971024 6:127815476-127815498 GAGTTTCTGAAGATGCAGCAAGG + Intronic
1015182338 6:130374031-130374053 ATGTTTCTGAACATGCAGATAGG + Intronic
1016555899 6:145337947-145337969 ATTTTTCTGAAGATTCTGCAAGG - Intergenic
1016619608 6:146092729-146092751 CTGCTTCTTCAGATGCAGCAGGG - Intronic
1019796755 7:3055430-3055452 CTGATCCTGCAGCTGCAGCATGG - Intergenic
1020915247 7:14184604-14184626 GTCTTGCTGCAGCTGCAGCATGG - Intronic
1022339453 7:29454662-29454684 ATTTTTGGGCAGAAGCAGCAGGG - Intronic
1023259718 7:38346004-38346026 ATGTGTCTGCAGATGCGAAAAGG - Intergenic
1023766616 7:43517559-43517581 AAGACTCTGCAGATGTAGCAAGG - Intronic
1024774816 7:52771729-52771751 ATTTTTCTGCAGATACAGTCTGG - Intergenic
1028883372 7:95905287-95905309 GTGTTTCTGCACACGCAACATGG - Intronic
1029176132 7:98665843-98665865 TGGGTGCTGCAGATGCAGCAGGG - Intergenic
1031528499 7:122850024-122850046 ATCAAACTGCAGATGCAGCAGGG - Intronic
1033667613 7:143457647-143457669 ATGTACCTGCAACTGCAGCAAGG - Intergenic
1034778120 7:153850395-153850417 TTGCTTCTGCAGAGCCAGCAAGG + Intergenic
1037572675 8:20172035-20172057 ATGTTTCTCCATAGGCCGCAAGG - Intronic
1039369737 8:36972648-36972670 ATGTGTGTGCAGCTGCACCACGG + Intergenic
1040507554 8:48064004-48064026 ATGGTTCTGCTGATGCATCATGG + Exonic
1041746331 8:61212398-61212420 ATGCCTCAGCAGATGCAGCGGGG + Intronic
1042964666 8:74337644-74337666 AGCTTTCAGCAGATGCAGCAAGG + Intronic
1047787178 8:128164981-128165003 TTGTTTCTGCAGAGGCAGGCTGG + Intergenic
1048164779 8:132052944-132052966 ATGATTCAGCAGAGGCAGCAGGG - Intronic
1050227247 9:3473945-3473967 ATGTTTCTGAAAATGTAGCATGG + Intronic
1050731932 9:8718699-8718721 ACGTTTCTGCAGATGTAGGAAGG - Intronic
1054877869 9:70115246-70115268 CTGTTTCTTCAGATGCATCTGGG + Intronic
1055686237 9:78777962-78777984 AAGTTCCTGCTGTTGCAGCAGGG - Intergenic
1056814361 9:89791051-89791073 TTGTTTCTGCAGAACCAGCAAGG + Intergenic
1056841363 9:90000226-90000248 CTCTTTCTGCAGGAGCAGCAGGG - Intergenic
1057217229 9:93235819-93235841 CTGCTTCTGCAGGTGCACCAGGG + Intronic
1059728918 9:117036879-117036901 ATTTGTCTGCAGATGCCGAAAGG - Intronic
1060016528 9:120091403-120091425 ATGATTCAGGAGATGGAGCAGGG + Intergenic
1060923138 9:127436753-127436775 ATGTTTCTAAAGATGCAGCCTGG + Intronic
1061473838 9:130849439-130849461 ATGTATCTGCAGATTTGGCAAGG + Intronic
1061952293 9:133943296-133943318 AGGTTGCTGCAGGTGCATCATGG + Intronic
1185759877 X:2682354-2682376 ATGTGTCTGTATTTGCAGCAAGG - Intergenic
1190203050 X:48380737-48380759 TTGTTTCTGCATTTTCAGCAAGG + Intergenic
1190207488 X:48414676-48414698 TTGTTTCTGCATTTTCAGCAAGG - Intergenic
1190596638 X:52059034-52059056 ATGGTTCTTCACATGCAACACGG + Intergenic
1190612186 X:52195039-52195061 ATGGTTCTTCACATGCAACACGG - Intergenic
1192495615 X:71615056-71615078 CCGTTTCTGCAGTTTCAGCAGGG + Intergenic
1193334025 X:80266161-80266183 ATGTGTCTGCAGATGTGGGATGG - Intergenic
1194650400 X:96507753-96507775 ATGTTCATGCATGTGCAGCAGGG + Intergenic
1196109388 X:111929995-111930017 ATGTTTGAGCAGAGGCAGAATGG - Intronic
1196396372 X:115266622-115266644 ATGTTTCTAAAGATGTAGAATGG - Intergenic
1197699734 X:129590025-129590047 ATGTGCCTGCATATGCAGTAAGG - Intronic
1198227332 X:134657511-134657533 CTGTTACTACAGAGGCAGCAGGG - Intronic
1198785602 X:140284207-140284229 ATCTTCCAGCAGAGGCAGCATGG - Intergenic
1198811210 X:140538142-140538164 AGCTCTCTGCAGATGCAGGATGG + Intergenic
1200413678 Y:2886590-2886612 ATGTTTCTGCAATTGGAGAAGGG + Intronic
1201225074 Y:11810788-11810810 TTGTATCTGCAGATGGAGGAAGG - Intergenic
1201567458 Y:15381832-15381854 ATTTTTCTGCAGATACTGAATGG - Intergenic
1201782770 Y:17741672-17741694 AAGTTTCTGCAGAGGAAACAAGG + Intergenic
1201818783 Y:18164316-18164338 AAGTTTCTGCAGAGGAAACAAGG - Intergenic
1202073995 Y:21020385-21020407 AGGTTTCTGCAGGTGTAGCTGGG + Intergenic
1202078695 Y:21062240-21062262 AGGTTTCTGCAGGTGTAGCTGGG + Intergenic