ID: 990404319

View in Genome Browser
Species Human (GRCh38)
Location 5:55472898-55472920
Sequence TAGAGCAGGACACTGATTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990404319_990404321 -8 Left 990404319 5:55472898-55472920 CCAGCAATCAGTGTCCTGCTCTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 990404321 5:55472913-55472935 CTGCTCTACTGCAGCCCTCCAGG 0: 1
1: 0
2: 4
3: 22
4: 278
990404319_990404325 25 Left 990404319 5:55472898-55472920 CCAGCAATCAGTGTCCTGCTCTA 0: 1
1: 0
2: 0
3: 6
4: 130
Right 990404325 5:55472946-55472968 TTCCTGTAGTTCTGCTAGCATGG 0: 1
1: 0
2: 1
3: 8
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990404319 Original CRISPR TAGAGCAGGACACTGATTGC TGG (reversed) Intronic
900616045 1:3566137-3566159 AAGAACAGGACAGTGACTGCAGG - Intronic
900673239 1:3868776-3868798 TAGGACAGGACACCCATTGCAGG - Intronic
901543343 1:9936369-9936391 TAGAGAAGTAAACTTATTGCAGG - Intronic
901758265 1:11454467-11454489 TCGAGCAGGAAGCAGATTGCAGG + Intergenic
904343205 1:29851491-29851513 GAGAGCCTGAAACTGATTGCAGG - Intergenic
912306296 1:108570974-108570996 TAGAGCAGGCCACAGTTGGCAGG + Intronic
912472560 1:109915603-109915625 GAGAGCAGGCCAACGATTGCAGG - Intronic
914499125 1:148228754-148228776 TAGAAGAGGACACTGAGTTCTGG + Intergenic
915103985 1:153521001-153521023 TTGTGCAGGACACAGATTGGAGG + Intergenic
915702917 1:157812733-157812755 GTGTGCAGGACACTGAGTGCAGG + Intronic
915971293 1:160356956-160356978 TAGAGCATGGCACTGATAGAGGG + Intronic
916207612 1:162330750-162330772 CAGAGCAGCACACTGTTTACAGG + Intronic
916887288 1:169082232-169082254 GAGAGCAGATCACTGGTTGCTGG + Intergenic
918553004 1:185765816-185765838 TAGATTAGAACACAGATTGCTGG - Intronic
919570792 1:199244396-199244418 TTGACCAGGACACAGATTGGAGG - Intergenic
919967716 1:202545451-202545473 AAGGGCAGGACACCGCTTGCAGG - Intronic
922723049 1:227908571-227908593 TGGACCAGGACACTGACTTCAGG + Intergenic
1063858235 10:10278966-10278988 TGGAGCAGGACAGTGATTCTAGG - Intergenic
1064485865 10:15789023-15789045 AAAAGCAGGACAGTAATTGCTGG + Intronic
1067438535 10:46295213-46295235 TAGAGCAGGAAACTGAGTCAGGG + Intronic
1070153658 10:73820235-73820257 AAGAGCAGGACAGAGATTCCCGG + Intronic
1070772514 10:79090551-79090573 TGGAGAAGGACACAGATTTCTGG - Intronic
1071325404 10:84510970-84510992 TAAAGCAAGACACTGATTTGGGG + Intronic
1075642884 10:124077586-124077608 CAGAGCAGGGCACTGGTTGGAGG - Intronic
1077087497 11:761675-761697 CAGAGCAGGTCAGTGATGGCAGG - Intronic
1083339797 11:61951744-61951766 TAGAGAGGGACACCGATTGGGGG - Intronic
1087220949 11:95545691-95545713 AAGAGCAGGACACTGACTGAGGG - Intergenic
1090234570 11:125138043-125138065 TTTAACAGGACACTGCTTGCTGG + Intergenic
1092025777 12:5238976-5238998 TTGAGCAGGACATTGCTTTCTGG + Intergenic
1096688297 12:53303680-53303702 AAGAGCAGGAAGCTGCTTGCAGG - Intronic
1099313077 12:81052234-81052256 AAGAGCAGGACACTGTATGTTGG - Intronic
1100313870 12:93425280-93425302 TAGAGCAAAACACTGATTTAGGG - Intronic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1101273679 12:103175936-103175958 TAGATCAGCACACTGGATGCTGG + Intergenic
1102220172 12:111188842-111188864 TGGTGCAGGAGACTGCTTGCTGG - Intronic
1102262109 12:111449440-111449462 TAGAACAGAACACTGATTGTGGG - Exonic
1103588609 12:121974422-121974444 TAGTGGAGGACACTGATGCCAGG + Intronic
1107700934 13:43046940-43046962 TCGAGCTGAACACTGGTTGCTGG + Intronic
1108947046 13:56040136-56040158 TAGAGCTGAACACTAGTTGCTGG - Intergenic
1109239068 13:59861015-59861037 TAGGGAGGGACACTGATTGCTGG + Intronic
1110411723 13:75211458-75211480 GAAAGCAGGCCAGTGATTGCCGG + Intergenic
1113246536 13:108402909-108402931 TAGAGCAGGGCCCTGAGAGCAGG - Intergenic
1114221280 14:20699679-20699701 TAGTGAAGGTCACAGATTGCAGG + Exonic
1121898842 14:97673807-97673829 TAGAGCAAGGCTCTGACTGCAGG + Intergenic
1124374981 15:29124115-29124137 TGGAGCAGGGCACTGAGTGGTGG - Intronic
1124581999 15:30964633-30964655 TAGAGCAGGCCACTGGTATCAGG - Intronic
1125777427 15:42229642-42229664 TAGTGCAGGCAACTGATGGCAGG - Intronic
1129360492 15:75021088-75021110 TAGGACAGGAAACTGATTGGAGG - Exonic
1131135398 15:89930943-89930965 GAGAGCAGGATAGTGGTTGCCGG + Intergenic
1134048779 16:11122150-11122172 GAGAGCAGGACACAGACAGCAGG - Intronic
1135113633 16:19708850-19708872 GAGAGCAGGAGACTGCTAGCTGG + Intronic
1137402160 16:48162709-48162731 GAGGGCAAGACACAGATTGCTGG - Intergenic
1137446882 16:48537343-48537365 GAGGGCACGACACTGGTTGCCGG + Intergenic
1142915556 17:3133694-3133716 TATAGCAGGACCCTAATTCCAGG - Intergenic
1147551906 17:41449148-41449170 TAGAGCAGGACATGGCCTGCAGG + Intergenic
1147612947 17:41812229-41812251 GAGATCAGGACACTGAGTGAGGG + Intronic
1147636511 17:41967408-41967430 TAGAGCTGGATCCTAATTGCAGG + Intronic
1154349127 18:13568403-13568425 CAGAGCTGGACACTAAGTGCTGG - Intronic
1157323132 18:46649279-46649301 GAGAGGAGGAGACAGATTGCAGG + Intronic
1158476696 18:57786415-57786437 TTTATTAGGACACTGATTGCTGG + Intronic
1160379060 18:78436278-78436300 TAGAGCTGCACACTGATGGCTGG - Intergenic
1160443838 18:78912538-78912560 CAGAGCAGGACACAGCTTGGAGG + Intergenic
1162949688 19:14063376-14063398 TAGAGATGGACACAGATTGGTGG - Intergenic
1166623919 19:44332318-44332340 TGGGGCAGCACACTGATTGTGGG + Intronic
1167434720 19:49472846-49472868 TAGGGCAGGACACACATTGAGGG + Intronic
1167511227 19:49896283-49896305 GAGAGCAGGACAGTGACTGGGGG - Intronic
926756423 2:16240055-16240077 TAGAGCAAGACTATGGTTGCAGG - Intergenic
927417028 2:22890443-22890465 GAGAGCAAGACACTGCCTGCAGG - Intergenic
930607432 2:53507077-53507099 TAGATGAGGAAACTGAGTGCAGG + Intergenic
931867117 2:66425480-66425502 TAGAGCAGGACAGTCATTTACGG + Intergenic
935214785 2:100967520-100967542 TACAAAAGGACACTGATGGCTGG - Intronic
939038033 2:137156491-137156513 TAGAGAAGGACATGGTTTGCTGG - Intronic
1168777365 20:459284-459306 TAGAGCAGGACACACATTTCTGG + Intronic
1170311376 20:14996457-14996479 TAGAGGAGGAAGATGATTGCTGG - Intronic
1171383208 20:24748648-24748670 TTTAGAAGGAGACTGATTGCAGG - Intergenic
1171934130 20:31257497-31257519 TAGAGCAGGACCCTGAACACCGG + Intergenic
1171955333 20:31457636-31457658 ATGAGCAGGACAGTGACTGCAGG - Intergenic
1172128979 20:32643205-32643227 CAGAGTAGGACACTGATCCCAGG - Intergenic
1173019311 20:39253867-39253889 TAGATCAGGACTCAAATTGCAGG + Intergenic
1175982998 20:62750265-62750287 GAGAGCAGAGCACTGAGTGCTGG + Intronic
1177426385 21:20927836-20927858 TCGAGCTGAACACTGGTTGCTGG + Intergenic
1178052201 21:28759968-28759990 TAGTGCAGGACACAGATCCCAGG - Intergenic
1180676713 22:17591508-17591530 TGGAGCAGGTCACTGTGTGCTGG - Intergenic
1183537858 22:38413539-38413561 CAGAGCGGGACCCTGATTCCAGG + Intergenic
1183658240 22:39203343-39203365 TGGAGGAGGACACAGATGGCCGG + Intergenic
950258991 3:11530254-11530276 GAGAGCATGCCACTGCTTGCAGG - Intronic
950510395 3:13422317-13422339 TAGAGCAGGTGAGTGATTGTGGG + Intergenic
952699207 3:36307754-36307776 TAGATCATTTCACTGATTGCTGG - Intergenic
953979256 3:47405554-47405576 CAGAGCAGGAGACTGAGGGCTGG + Intronic
956032024 3:65048802-65048824 ATGAGCAGGACACTGAGTGAGGG + Intergenic
956372578 3:68579544-68579566 TTCTGCAGGACAATGATTGCTGG + Intergenic
959426926 3:106201841-106201863 TAGTGTAGGGCCCTGATTGCAGG + Intergenic
963255713 3:143142657-143142679 TCGAGCTGAACACTGGTTGCTGG + Intergenic
967119818 3:186373022-186373044 TCTAGGAGGACACTGATGGCAGG - Intergenic
967227955 3:187311515-187311537 TAGAGCAAGAGTCTGATTCCAGG + Intergenic
970297202 4:14642581-14642603 AAGGGCAAAACACTGATTGCTGG + Intergenic
970361513 4:15313022-15313044 TAAAGCAGGAGACTGATGCCAGG - Intergenic
972238413 4:37161272-37161294 CAGAGCAGGACTTTTATTGCTGG - Intergenic
982461331 4:155672695-155672717 GAGAGCTGGACATTAATTGCAGG - Intronic
982544255 4:156712730-156712752 TACAGCAGGACTCTGAGTGTTGG - Intergenic
990404319 5:55472898-55472920 TAGAGCAGGACACTGATTGCTGG - Intronic
991269903 5:64767783-64767805 CACTGCAGAACACTGATTGCAGG - Intronic
994490329 5:100434783-100434805 TAGAGCAGGACAAAGATGGGTGG - Intergenic
996369965 5:122742676-122742698 AAGAGAAGGATACTGAATGCTGG - Intergenic
1000279832 5:159773140-159773162 TAGAGCAGGTGACTGAATGAGGG + Intergenic
1002614342 5:180441614-180441636 TAGCTCAAGACTCTGATTGCTGG + Intergenic
1006517161 6:34551455-34551477 CAGAGCAGGAGACTGAGGGCTGG - Intronic
1009422594 6:63480270-63480292 TAGAGCATGACACAAATTACCGG - Intergenic
1012120046 6:95354902-95354924 TAGAGCTGAACACTAGTTGCTGG + Intergenic
1013737477 6:113244587-113244609 TACAGCAGGGGAATGATTGCTGG - Intergenic
1018182128 6:161233216-161233238 TTGAGCTGGAGACTGATTACAGG - Intronic
1019609280 7:1928784-1928806 GAGAGCTGGGCACTGATTTCTGG + Intronic
1023724054 7:43123845-43123867 GAGAGCAGGACACAGACTTCTGG - Intronic
1024241920 7:47442337-47442359 GAGGGCAGGGCACTGTTTGCAGG - Intronic
1027230902 7:76271824-76271846 GAGAGCAGGAAGCTGATTTCTGG - Intronic
1027796379 7:82698846-82698868 TAAAGCAGGCCACTCATTACGGG - Intergenic
1028153798 7:87406765-87406787 CAGAGTAGGACACAGATGGCTGG - Intronic
1034217524 7:149420049-149420071 CAGAGCAGGACAGTGATTTGAGG + Intergenic
1035401548 7:158569513-158569535 GAGAGCAGGACCCTGAGAGCCGG - Intronic
1038628466 8:29217427-29217449 TAGAGCAGGAAACTGAAGCCTGG - Intronic
1040478232 8:47799707-47799729 CTGTGCAGGACACTGAGTGCAGG - Intronic
1041741671 8:61163710-61163732 TAGAGCTGAACACTAGTTGCTGG - Intronic
1046952539 8:120031990-120032012 AAGAGCTGGACACAGAGTGCGGG + Intronic
1047824907 8:128562804-128562826 TAGAGCAAGACTCTGTCTGCTGG - Intergenic
1050586175 9:7113905-7113927 CAGAGCAGGAACCTGAATGCAGG - Intergenic
1051627228 9:19109937-19109959 CAGAGCAAGACACTGTTTACAGG + Intronic
1053384955 9:37679759-37679781 CAGAGCAGGAACCTGATTGCTGG + Intronic
1055708929 9:79037545-79037567 TGGAGCAGGACACGGATATCTGG + Intergenic
1057369385 9:94456289-94456311 GAGACGAGGGCACTGATTGCCGG - Exonic
1186689825 X:11963552-11963574 TTGAGAAAGACAATGATTGCTGG + Intergenic
1188966424 X:36558807-36558829 TAGAGGAGGACATTGACTGATGG - Intergenic
1190604503 X:52126820-52126842 TTGAGCAGGCCACTCTTTGCTGG + Intergenic
1191085663 X:56564528-56564550 TTGAGCAGGTGACTGATTTCTGG - Exonic
1196371617 X:114985490-114985512 TAAAGCAGGACACAGATTTGAGG + Intergenic
1200849210 Y:7865467-7865489 TAGAGCTGAACACTAGTTGCTGG - Intergenic
1202303541 Y:23443436-23443458 AAGGGCAGGACACCGCTTGCAGG - Intergenic
1202567269 Y:26227158-26227180 AAGGGCAGGACACCGCTTGCAGG + Intergenic