ID: 990405723

View in Genome Browser
Species Human (GRCh38)
Location 5:55488735-55488757
Sequence GTCTTCAGGTAGTAGAACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 110}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990405723 Original CRISPR GTCTTCAGGTAGTAGAACTA AGG Intronic
904092485 1:27955056-27955078 GATCTCAGGTAGCAGAACTATGG + Intronic
904344767 1:29860599-29860621 CTCTTCAGGTAGAGGAACTGAGG - Intergenic
904451103 1:30612164-30612186 GTCTTGAGGTATAAGAACCAGGG - Intergenic
906027932 1:42690840-42690862 GTCTTCAAGATGTAGAAATAAGG - Intronic
908190149 1:61694554-61694576 TTCTTCATGTACTAGATCTAAGG - Intronic
908501418 1:64746239-64746261 ATCTTCAGGTATCAGAAATATGG - Intronic
908663422 1:66462694-66462716 GGCTTGAGGTATTAGACCTATGG + Intergenic
909201375 1:72693829-72693851 GTCTGCACCTAGTAGAACTGAGG - Intergenic
909591669 1:77356553-77356575 GTTTTCAGATGGTAGAACTGAGG - Intronic
911064500 1:93775864-93775886 GACTCCAGGAAGTAGAACTGGGG + Intronic
917103058 1:171464858-171464880 GTATTCAGGTATTAGAACATTGG - Intergenic
917740516 1:177957958-177957980 GTCTTTTAGTGGTAGAACTATGG + Intronic
919232591 1:194793438-194793460 TTCTCCAGGTTGTTGAACTAAGG + Intergenic
923235413 1:232028315-232028337 GTCTTCAGGTAGCAGTTCTGAGG + Intronic
923519185 1:234722818-234722840 GTCTTCAGCGAGAAGGACTAGGG - Intergenic
924330912 1:242939593-242939615 GTCTCCAGGTGGTAGAATTTGGG + Intergenic
1064533640 10:16335641-16335663 GTCTTCCGGCAGTAGAACAGGGG - Intergenic
1066263938 10:33756809-33756831 GTCTTCAGGGAGAAAAAATAAGG - Intergenic
1068482541 10:57611644-57611666 GTCTTATGGTTGTAGAACTGAGG + Intergenic
1071003145 10:80853969-80853991 GATTTCAGGTAGTCAAACTAAGG - Intergenic
1071578114 10:86745121-86745143 GTCTCCCAGTAGTAGGACTATGG - Intergenic
1071693527 10:87848206-87848228 GTCTTCAAATAGGAGAAATAAGG - Intergenic
1075028285 10:119003157-119003179 TTCTCCAGGTGGTAGAATTATGG - Intergenic
1077998314 11:7473093-7473115 GTCTTCAGGTATTTGAAGAAAGG - Intergenic
1078966061 11:16344840-16344862 GTTTTCAGGGGGTATAACTAGGG - Intronic
1080320381 11:31002186-31002208 ATCTTCAGGTAGTATAATTTGGG + Intronic
1081343296 11:41953626-41953648 CACTTCAGGTAGAAGAACTGAGG - Intergenic
1083631557 11:64097968-64097990 GTCTTCAGGGAGTAAAACCTGGG + Intronic
1084967803 11:72753474-72753496 GTCTTCTGGTGGTAGGGCTAAGG + Intronic
1088676017 11:112194197-112194219 GCCTTCAGATATTAGGACTAAGG - Intronic
1089630783 11:119782933-119782955 GTCTTAAGATCTTAGAACTAAGG - Intergenic
1097852042 12:64421565-64421587 ATCTTTAGGTAGTAGAATTATGG - Intronic
1100599332 12:96099383-96099405 GTCTGTAGGTGGTAGATCTAAGG - Intergenic
1103849774 12:123924926-123924948 GCCTTCAGTTAGTACACCTATGG + Intronic
1107930347 13:45301903-45301925 GTCTTCATGTGGTAGAAAGAAGG + Intergenic
1109445958 13:62440919-62440941 GTAGTCAGGTAGTAGGCCTAGGG + Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114470776 14:22959641-22959663 GTCTTCAGGTAGGAGGACAGAGG + Intronic
1116245011 14:42399021-42399043 GTTTTCAGGTAAATGAACTAAGG - Intergenic
1119445820 14:74662565-74662587 GTTATCAGGAAGGAGAACTAAGG - Exonic
1121961232 14:98262155-98262177 GTTTGTAGATAGTAGAACTATGG - Intergenic
1202888453 14_KI270722v1_random:131650-131672 GTCTTCAGGTCGAAGACCTAGGG - Intergenic
1128823471 15:70685106-70685128 GTCTTCAGGTAGAAGAATCAAGG - Intronic
1130718237 15:86358190-86358212 GTTTTCAGGGAGTAGAGCTTGGG - Intronic
1138840592 16:60499045-60499067 GTCTGGAGGTAGTAGAATGATGG - Intergenic
1139811320 16:69620301-69620323 GTATCCATGTAGTAGAATTAGGG - Intronic
1146156925 17:30532286-30532308 GTCTTTAGGTAGAAGACCAAAGG + Intergenic
1146527858 17:33582052-33582074 GTCTTCAGGAAGGAGAATAAGGG - Intronic
1146568079 17:33930480-33930502 TGCTTCAGGTAGTAGAATAAGGG + Intronic
1148587941 17:48794203-48794225 GTCTCGGGGTAGCAGAACTAAGG - Intronic
1150827844 17:68492366-68492388 GTCTGCACCAAGTAGAACTAAGG - Intergenic
1151250456 17:72829914-72829936 GTGTTCAGGAAGTTGACCTAGGG + Intronic
1153928687 18:9859025-9859047 GGCTTCATGCAGCAGAACTAGGG + Intronic
1157047003 18:44113395-44113417 TTCTGCAGGGAGTAGAACAAAGG + Intergenic
1161494106 19:4578293-4578315 GTCTTCATGTAGCAGCAGTAGGG - Intergenic
1164087528 19:21917315-21917337 GTCTTCTGAAAGTAGAACAAAGG - Intergenic
1202663852 1_KI270708v1_random:98442-98464 GTCTTCAGGTCGAAGACCTAGGG - Intergenic
927939897 2:27096945-27096967 GTCTTCAGGTGAGAAAACTAAGG + Intronic
929719180 2:44349534-44349556 GTCTTAAGGAAGTAGAAGAAAGG + Intronic
932431847 2:71680780-71680802 GTCTCCATGTAGTGGAAGTAGGG + Intronic
934136985 2:89005555-89005577 GTCATCAGGTAGAAGTTCTAGGG - Intergenic
934234120 2:90214934-90214956 GTCATCAGGTAGAAGTTCTAGGG + Intergenic
936915054 2:117631729-117631751 GTTTCCAGGTAGCAGAACTATGG - Intergenic
937407633 2:121645285-121645307 TCCTTCAGGAAGTATAACTAAGG + Intronic
940655534 2:156483871-156483893 TTCTTCAGGTTCTTGAACTAAGG + Intronic
944643749 2:201756402-201756424 GTGTTCAGTAAGTAGAACAAGGG + Intronic
947278047 2:228417087-228417109 GTCTGCAAGTTGGAGAACTAAGG + Intergenic
948257850 2:236580997-236581019 GTCTTCAGGTAGTAGGTGTCAGG - Exonic
1169141524 20:3229755-3229777 GTCTTCTGGAAGTACTACTATGG - Exonic
1173107484 20:40151419-40151441 GTCCACATGTAGTAGAACTATGG - Intergenic
1176983505 21:15409826-15409848 GTCTTCAGGTAGTAGAATCGTGG - Intergenic
1178562015 21:33647262-33647284 GTATGCAGGTAGTAGACTTACGG - Intronic
1180330575 22:11475326-11475348 GTCTTCAGGTCGAAGACCTAGGG - Intergenic
952171801 3:30815390-30815412 GTCTCCAGGTATGAGAATTATGG + Intronic
953139423 3:40213733-40213755 GTCCTCAGGTAGTTGGACTTTGG - Intronic
954407428 3:50353235-50353257 GTCATCAGGAAGGAGAACTGAGG - Exonic
957092106 3:75741166-75741188 GCCTTCAGGTCGAAGACCTAGGG + Intronic
959176492 3:102919322-102919344 GTCTTCAACTAGTTGAATTAAGG - Intergenic
962214551 3:133509783-133509805 GTCTTCAAGTAGTGGAAAGATGG + Intergenic
962883218 3:139598787-139598809 ATTTTCAGGTAGTATAACCATGG - Intronic
963185713 3:142414412-142414434 ATATTCAGATAGTAGAATTATGG - Intronic
964309684 3:155379414-155379436 GTGTTCTGGTAGTGGTACTATGG + Intronic
969713336 4:8857104-8857126 ATCTCCAGGTAGTCGAACTTGGG + Intronic
979661683 4:123263017-123263039 GTCTTCATGTAGAAGTAGTAGGG + Intronic
980075034 4:128286532-128286554 GTTTTCACTTAGCAGAACTAAGG - Intronic
981736327 4:147956139-147956161 GGTTTTAGCTAGTAGAACTAGGG - Intronic
987231756 5:15901306-15901328 GTCTTCACGTGGTAGAAGAAGGG + Intronic
987284697 5:16444051-16444073 GTCTTCTGATAGGAGAACAAAGG - Intergenic
990405723 5:55488735-55488757 GTCTTCAGGTAGTAGAACTAAGG + Intronic
990493662 5:56325845-56325867 GTCATCAGGTGATGGAACTAGGG + Intergenic
994669190 5:102746349-102746371 TTCTTCCAGTTGTAGAACTAAGG + Intergenic
995410966 5:111856624-111856646 GTGGTCAGGTAGTTGAGCTAAGG - Intronic
996535512 5:124573126-124573148 GACATCAGGCAGGAGAACTAGGG + Intergenic
998886297 5:146698059-146698081 CTCTTCAGGTAATCGAACTCGGG + Exonic
1006839131 6:37016955-37016977 GCCTTCAGGAAGGGGAACTAGGG - Intronic
1012912130 6:105130100-105130122 TTCTTAAAGTAGTAGAATTATGG - Intronic
1014877644 6:126680472-126680494 ATATTCAGGCAGTAGAAATATGG + Intergenic
1021133276 7:16936369-16936391 GTCTTCAGGTAGGAAATCTTTGG - Intergenic
1028689093 7:93630297-93630319 TTCTTCAGGTAGTATAGCTCTGG + Intronic
1028852879 7:95556292-95556314 TCTTTCAGGAAGTAGAACTAGGG + Intergenic
1030520984 7:110597850-110597872 ATGTTCAGGTAGTATAACTTGGG - Intergenic
1031377102 7:121040407-121040429 CTCTTCATGTAGGAGATCTATGG - Intronic
1038625373 8:29187620-29187642 GTTTTCGGGCAGTAGGACTATGG - Intronic
1039077389 8:33704052-33704074 GTCTTCAGGTATCATAAATAAGG + Intergenic
1039365028 8:36920204-36920226 GTCTGCAGGAAGTAGAGCCAGGG - Intronic
1045130454 8:99146375-99146397 GTTTTCAGTTAGTAGACCTGTGG + Intronic
1047239799 8:123076031-123076053 GTCTGCAGGTAATAGCAATATGG - Intronic
1048143016 8:131813503-131813525 GTCTTCTGGTAGTATGATTAAGG - Intergenic
1048510345 8:135056248-135056270 GCCTGCAAGTAGTAGAAATAAGG + Intergenic
1050853250 9:10316338-10316360 GTCTTCTGTTACTATAACTAAGG - Intronic
1051938623 9:22475613-22475635 CTCTTCAGCTAGTAGAATAATGG + Intergenic
1055011147 9:71566815-71566837 ATCTTAAGCTAGCAGAACTATGG - Intergenic
1055127827 9:72739198-72739220 GTCTTCATGTAGTGGAAGCAGGG + Intronic
1055702115 9:78956361-78956383 GTCTTCAGGTAGTTGTACCAGGG + Intergenic
1059421633 9:114196067-114196089 GTCTTCAGGCAGAAGAGCTGTGG + Intronic
1060465083 9:123896575-123896597 GACTTCAGGTATTAGAATTATGG + Intronic
1061806345 9:133139644-133139666 TTTTTCAGGTAGGGGAACTACGG - Intronic
1203485646 Un_GL000224v1:51572-51594 GTCTTCAGGTCGAAGACCTAGGG - Intergenic
1192134146 X:68581305-68581327 GTTTTAAGGTAGGAGAAATAGGG - Intergenic
1194019585 X:88670259-88670281 TTCTTCAGGTTGTAGAAGCAAGG + Intergenic
1195619703 X:106940837-106940859 TTCTTTAGGTGGTAGGACTATGG - Exonic
1199900008 X:152163850-152163872 GGGTACAGGTAGTAGAAGTAGGG + Intergenic