ID: 990408472

View in Genome Browser
Species Human (GRCh38)
Location 5:55516133-55516155
Sequence GGTGACATGTTGAAGGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990408472 Original CRISPR GGTGACATGTTGAAGGTGTA GGG (reversed) Intronic
904014388 1:27408805-27408827 GGTGAGATGATGAAGGGGGAGGG + Intronic
911744923 1:101430902-101430924 TGGGACATGTTGGAGGTGTGGGG - Intergenic
912333754 1:108843892-108843914 AGGGGCATGTTGAAGATGTATGG + Intronic
918892093 1:190287252-190287274 TGTGAGATGTTGAAGCTATATGG - Intronic
923328132 1:232898570-232898592 GGTGACATGTAGATGGTGGCAGG + Intergenic
923917987 1:238530307-238530329 GATGACATGTTGATGGTGGCAGG - Intergenic
924947023 1:248853470-248853492 GGTGACATGTTCCAGGAATAGGG - Intronic
1065338354 10:24678420-24678442 GGGGACATGTAGGAGGTGGAGGG - Intronic
1066935508 10:41827223-41827245 TGTGACAGGTTTAAGGTATATGG - Intergenic
1068618639 10:59151912-59151934 GTTGAAATGGTGAAAGTGTAGGG + Intergenic
1071100043 10:82025945-82025967 GGTGACATGTGGATGGAGCAGGG - Intronic
1072974310 10:100044311-100044333 GGTGACATGTGGAAGGCCTTGGG + Intronic
1073119589 10:101113407-101113429 GGGGACATGTAGAGGGAGTAGGG + Intronic
1074378665 10:112960552-112960574 AGTGCCATTTTGAAGGTGTGAGG + Intronic
1074907707 10:117879534-117879556 GGTGACATGTTGCTGGAGGATGG - Intergenic
1078644618 11:13128995-13129017 GGTTGCATGTTGAAGGTTAAGGG - Intergenic
1080416651 11:32075181-32075203 GGAGGCATGTTGATAGTGTAAGG - Intronic
1081206033 11:40276830-40276852 GGCGATATGCTGAAGGAGTAAGG + Intronic
1083146371 11:60762736-60762758 GGGGAGATGTTGAGGGTGCACGG + Intronic
1085895574 11:80635565-80635587 TTTGACATGTTGAGGCTGTAAGG - Intergenic
1086248394 11:84783785-84783807 TTTGACATGTTGAACATGTATGG - Intronic
1086947087 11:92853988-92854010 GATGACATGTTGATGGTGGCAGG - Intronic
1087011742 11:93520834-93520856 CGTGACATGCTGAAGGTGAAAGG - Intronic
1088625259 11:111725721-111725743 GGTGACGTGTGGAAAGTCTAGGG + Exonic
1089406901 11:118205089-118205111 GGTGACATCATGATGGAGTATGG - Intronic
1089862544 11:121602873-121602895 GGTGACATCTTGTAGGTTAACGG - Intronic
1090084576 11:123640167-123640189 GGTGAGATGTTTGAGCTGTACGG - Intronic
1090432067 11:126654436-126654458 TCTGAAATGTTGAAGGTGGAGGG + Intronic
1091441266 12:512866-512888 GGTGGAATGTGGAAGGTGGAAGG - Intronic
1095238420 12:39827592-39827614 GGATGCATGTTGGAGGTGTAGGG + Intronic
1095398181 12:41784797-41784819 GGTTTCATGTTGAAGGTAAATGG + Intergenic
1095781652 12:46066954-46066976 AGTGGCATGGTGAAGGTGAAAGG - Intergenic
1096267385 12:50134597-50134619 GATGACATGCAGAAGCTGTAGGG + Exonic
1097969169 12:65613952-65613974 TGTGACATGTTGGTGGTGGAAGG + Intergenic
1100811099 12:98339091-98339113 AATGAGATGTTGATGGTGTATGG + Intergenic
1106155694 13:27153610-27153632 GGTGACTTGTGGAAGGGGAAAGG - Intronic
1106163527 13:27221327-27221349 GGTCAATTGTTGTAGGTGTATGG - Intergenic
1114647802 14:24265191-24265213 GGGAACATGTGGAAGGTGCAGGG + Intergenic
1121030378 14:90653657-90653679 GGTGCCATGTTGGAGGCGTTAGG - Intronic
1122556536 14:102583693-102583715 GGTGACATGTAGGTGGGGTAAGG + Intergenic
1123149430 14:106166735-106166757 GGTGACATGGGGAATGTGTGAGG - Intergenic
1123149473 14:106166964-106166986 GGTGACTTGGGGGAGGTGTAAGG - Intergenic
1123172895 14:106390860-106390882 GGTGACCTGTGGAATGTGTATGG - Intergenic
1125718861 15:41835634-41835656 AGTGACTTCTTGTAGGTGTAAGG + Exonic
1126054443 15:44716518-44716540 AGTGGCATGAAGAAGGTGTATGG + Intronic
1127982339 15:64044611-64044633 GGTGACATCTTGGAGGAGTTGGG - Intronic
1132867876 16:2102817-2102839 GGGGAAATGAAGAAGGTGTAGGG + Exonic
1134523897 16:14930297-14930319 GGGGAAATGAAGAAGGTGTAGGG - Intronic
1134549007 16:15130638-15130660 GGGGAAATGAAGAAGGTGTAGGG + Intronic
1134711488 16:16328782-16328804 GGGGAAATGAAGAAGGTGTAGGG - Intergenic
1134719339 16:16372081-16372103 GGGGAAATGAAGAAGGTGTAGGG - Intergenic
1134948087 16:18339804-18339826 GGGGAAATGAAGAAGGTGTAGGG + Intergenic
1134955341 16:18379911-18379933 GGGGAAATGAAGAAGGTGTAGGG + Intergenic
1136781059 16:32902063-32902085 GGTGACCTGTGGGACGTGTAAGG + Intergenic
1142325876 16:89414129-89414151 GCTGAAATGTTGAACTTGTAAGG - Intronic
1143213636 17:5208027-5208049 GGTGCCATGTAGAAAGTGGACGG + Intergenic
1143999988 17:11044756-11044778 GGGGACTTCTTGAAGGTGGAAGG - Intergenic
1145776306 17:27531438-27531460 GGTCACATGTTGCAGGTCTCTGG + Intronic
1146969458 17:37061088-37061110 GGTGAGATCTTTAAGGTCTATGG - Intergenic
1149946331 17:60931672-60931694 GGTGACAAGGTGAAGGAGGAAGG - Intronic
1153608152 18:6855107-6855129 GATGGCATGTTGAAGGTGGGAGG + Intronic
1156089845 18:33454159-33454181 TGTGGCATATTGAAGGTGTAGGG - Intergenic
1156105898 18:33660240-33660262 GATCACATGTTGGAAGTGTATGG + Intronic
1156784624 18:40895116-40895138 GGTAACATTTTAAAAGTGTATGG + Intergenic
1156798382 18:41076763-41076785 GATGACATGTAGAAATTGTATGG - Intergenic
1156963990 18:43067987-43068009 TTTGACATGTTGATTGTGTAAGG + Intronic
1158753260 18:60291141-60291163 GGTGAGATGTAGAAGGGATATGG + Intergenic
1158856347 18:61546377-61546399 GGTGACATGTAGGAGGTTGAAGG - Intronic
1163782394 19:19257394-19257416 AGTGAGATGCAGAAGGTGTACGG + Exonic
1164352326 19:27365565-27365587 TGTGACGTGTTTAAGGTCTATGG - Intergenic
928581789 2:32715369-32715391 GATCACATGTTGTAGGTGTGTGG + Intronic
937077351 2:119116924-119116946 GGTTACAGGATGAAAGTGTAGGG + Intergenic
937087738 2:119182423-119182445 GGTGACAGGTTGGAGGAGGAGGG - Intergenic
940467113 2:154045029-154045051 GGTGACATGTCCATGGAGTAAGG + Intronic
943226490 2:185185315-185185337 GATGACATGTTGATGGTGGCAGG + Intergenic
943347125 2:186752243-186752265 GGTCACATGTTGAAGCTGGATGG + Intronic
945985912 2:216353499-216353521 GGGGACATGTTCAAGGTGGAAGG - Intronic
1168820411 20:769085-769107 TCTGACATTTTGAAGGTGGAAGG + Intergenic
1169621180 20:7508072-7508094 GGTGATATATTGGAGGTGGAGGG + Intergenic
1174197767 20:48785682-48785704 GGTGACATCTTGAAGGTTGGAGG - Intronic
1175421550 20:58837892-58837914 GGTGTGGTGTTGAAGGTGTGAGG + Intergenic
1178296707 21:31416199-31416221 GGTGGAGTGTTGAAGGTGCAGGG - Intronic
1178320183 21:31599230-31599252 TGTGACATGATGCAGGTTTAGGG + Intergenic
1179103685 21:38379118-38379140 GGTTAGATCTTGAAGGTGTTAGG - Intergenic
1179911424 21:44451079-44451101 GGTGTGATGGTGATGGTGTAGGG + Intergenic
1182085148 22:27556197-27556219 GGTGCCAGGTAAAAGGTGTAGGG + Intergenic
1184952016 22:47850039-47850061 GCTGACATCATGAAGGTCTAAGG + Intergenic
949523462 3:4878935-4878957 GGGGACACTTTGAAGGTGTGGGG - Intronic
950361167 3:12450449-12450471 GGTGACTTGTGGAAGGTGACTGG - Intergenic
950544401 3:13630039-13630061 GGTGTGAGGGTGAAGGTGTAAGG - Intronic
952399668 3:32951808-32951830 GGGGACAGGTAGAAGGTGTGTGG - Intronic
956785230 3:72636955-72636977 GCTGACAGATTGAAGGTGTGGGG - Intergenic
963969921 3:151418477-151418499 GTTGACATTTTTAAGGTCTATGG + Intronic
968981034 4:3849522-3849544 GGTGACAAGTTGATTGTGAAGGG - Intergenic
971468885 4:26997768-26997790 AGTGTCATGTTAAAGGTGTAAGG + Intronic
972032324 4:34477194-34477216 TGGGACATGTTTAAGGTGTTTGG + Intergenic
973909926 4:55569368-55569390 GGTTACTTGTTGAATCTGTATGG + Intronic
975099365 4:70494822-70494844 TGTGACATGATGAAAGTGTTTGG + Intergenic
975359689 4:73453648-73453670 GGTGATAGGTTGATGGAGTAAGG + Intronic
976278317 4:83301049-83301071 GGTGACATTATGGAGGTTTATGG + Exonic
976993060 4:91393733-91393755 GGTTTGATTTTGAAGGTGTATGG + Intronic
979414955 4:120425644-120425666 GGTTATATGTTGCAGGTGGATGG + Intergenic
982802630 4:159723179-159723201 GATGACATGTTGATGGTGGCAGG - Intergenic
983316370 4:166137309-166137331 GGTGACTGGATGAAGGTGAATGG - Intergenic
983856227 4:172648787-172648809 GGTGACATCTTGAAGCTGGCAGG - Intronic
984549451 4:181143140-181143162 AGTTACATCTTGAAGGTGTTAGG + Intergenic
984793291 4:183633833-183633855 GGTGACATATCAAAGGTGTGAGG - Intergenic
985948098 5:3202231-3202253 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948110 5:3202295-3202317 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948122 5:3202359-3202381 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948134 5:3202423-3202445 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948145 5:3202487-3202509 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
985948157 5:3202551-3202573 GGTGACAGGCTGCAGGTGCAGGG - Intergenic
986053794 5:4115681-4115703 GGTGACAAGTTGAAAATGTGCGG - Intergenic
987022776 5:13891681-13891703 GGTTAAATATTGAAGATGTAAGG - Intronic
987899466 5:23992603-23992625 GGTGAATTGTAGAAGGTGTTTGG + Intronic
988635844 5:32983329-32983351 GATGACATGTTGAAAGTGATGGG + Intergenic
990408472 5:55516133-55516155 GGTGACATGTTGAAGGTGTAGGG - Intronic
992493629 5:77270559-77270581 GGTGACATGTTGATGGTATTTGG + Intronic
993107543 5:83616397-83616419 GGTGAAATGTCTAAGGTGTAAGG - Intergenic
994246962 5:97489179-97489201 GATGACATGTTGATGGTGGGAGG - Intergenic
994342490 5:98647594-98647616 GGTCACATTTTGATGGTGTTAGG - Intergenic
995599758 5:113782516-113782538 GGAGGCATATTGAGGGTGTAGGG + Intergenic
995969375 5:117949253-117949275 GGTGATGTGTTGAAGGAATATGG + Intergenic
999426817 5:151495019-151495041 GGTGAAATGATGAGGTTGTATGG + Intergenic
999588982 5:153123246-153123268 GGTGGCATGTAGGTGGTGTAGGG - Intergenic
1001031698 5:168267937-168267959 GGTGACATCTGGAAAGTGGAGGG + Intergenic
1002678053 5:180935296-180935318 GATGGCATGTTGATGGTGGAAGG - Intronic
1002864425 6:1108347-1108369 GGATAGATGTTGAAGGTGTTGGG - Intergenic
1004720854 6:18266209-18266231 GATGACATGTTGATGGTGGGAGG - Intergenic
1006214190 6:32425280-32425302 TGTTAAATGTTGAAGATGTATGG - Intergenic
1007318071 6:41005698-41005720 GGTGACATGTCAAAGGAGCACGG + Intergenic
1007360297 6:41350737-41350759 CGTGACCTGTTGAAGGTGGCAGG - Exonic
1010466253 6:76169984-76170006 GCTTAGATGTTGTAGGTGTATGG - Intergenic
1010697707 6:78997518-78997540 GTGGACAAATTGAAGGTGTACGG - Exonic
1010846857 6:80720145-80720167 GGTGGCATGTTGATGGTGGGAGG + Intergenic
1012945189 6:105458340-105458362 GATCAAATGTTCAAGGTGTAAGG + Intergenic
1015132812 6:129832971-129832993 GGTGATAAGTTGAATGTGAAAGG + Intronic
1015637735 6:135295389-135295411 GGTGACATCTTGAAGTAGAATGG - Intronic
1017132355 6:151118490-151118512 AGTGGCATGTTGAAGGTGTCAGG + Intergenic
1019135506 6:169905227-169905249 GGTGACCTGCTGAAGGAGTGTGG + Intergenic
1021193987 7:17653834-17653856 GGTCACATTTTGAAGGACTAGGG + Intergenic
1024857064 7:53794615-53794637 GATGACATGTTGATGGTGGCAGG - Intergenic
1027233437 7:76284655-76284677 GGTGCCAGGTGGAAGGTGTGAGG - Intronic
1030343470 7:108407207-108407229 GGGGAAATGTTCATGGTGTATGG - Intronic
1030981132 7:116186419-116186441 GATGACATGTTGATGGTGGCAGG - Intergenic
1036932921 8:12973632-12973654 TGAAACATGTTGGAGGTGTAGGG + Intronic
1041256379 8:55982880-55982902 GGTGACAGGCTGAGGCTGTAGGG - Intronic
1041568495 8:59308663-59308685 GGTGTCATGTTTAAAGGGTAAGG - Intergenic
1042317908 8:67443908-67443930 GGTGACTGGTTGAATATGTAAGG + Intronic
1043373853 8:79625637-79625659 GGTGACCTTTTGAAGTTTTAAGG - Intronic
1043798676 8:84579041-84579063 GATGACATGTTGATGGTGGGAGG - Intronic
1046767768 8:118088906-118088928 TGTGACTAGTTAAAGGTGTATGG - Intronic
1047172692 8:122509546-122509568 AGAGACATGTTCAAGGTGTAGGG - Intergenic
1050444720 9:5707737-5707759 GGAAACAAGTTGAAGGTGGAAGG - Intronic
1051320020 9:15893129-15893151 GGTCAGATGTTGCAGGTGTGTGG - Intronic
1053602965 9:39629533-39629555 GGTGACATTATAAATGTGTAGGG + Intergenic
1053860614 9:42383281-42383303 GGTGACATTATAAATGTGTAGGG + Intergenic
1054250573 9:62712903-62712925 GGTGACATTATAAATGTGTAGGG - Intergenic
1054564681 9:66747415-66747437 GGTGACATTATAAATGTGTAGGG - Intergenic
1058695113 9:107552380-107552402 GATGACAGGTTGAGGGTGTAAGG + Intergenic
1058785268 9:108380873-108380895 AGTGACATATGGAAGGGGTAAGG - Intergenic
1060478819 9:124005319-124005341 GGGGTCCTGTTGAAAGTGTAGGG + Intronic
1062019403 9:134309401-134309423 GGTGACATGTTGCAGGAATAGGG + Intergenic
1186257749 X:7741121-7741143 GGTGCCATCTTGAAGGAGGATGG + Intergenic
1186886951 X:13923249-13923271 GGTGACATGTAGAAAATGTCTGG + Intronic
1188484290 X:30666114-30666136 AGTGAAATGCTGCAGGTGTATGG - Intronic
1189809739 X:44770632-44770654 AGTGACATGTTGAAGTAGAATGG + Intergenic
1190978717 X:55434483-55434505 GGAGACGTGTTGAAGTTGTAAGG + Intergenic
1192635305 X:72809979-72810001 GGTGAGATATTGAAGTTGTTTGG + Intronic
1192646409 X:72910824-72910846 GGTGAGATATTGAAGTTGTTTGG - Intronic
1194483980 X:94463981-94464003 AGTGACATCATAAAGGTGTATGG + Intergenic
1195745743 X:108116319-108116341 GGTGCGATGTTGAAAGGGTATGG + Intronic
1201749260 Y:17414507-17414529 GGTCACAAGTTTAAGCTGTAAGG - Intergenic