ID: 990409513

View in Genome Browser
Species Human (GRCh38)
Location 5:55527179-55527201
Sequence TCTGGGTCCCTTCCTCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 258}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990409513_990409521 8 Left 990409513 5:55527179-55527201 CCCCTTTGAGGAAGGGACCCAGA 0: 1
1: 0
2: 2
3: 26
4: 258
Right 990409521 5:55527210-55527232 TAACAAAGGGACCGCTCCTTAGG No data
990409513_990409524 22 Left 990409513 5:55527179-55527201 CCCCTTTGAGGAAGGGACCCAGA 0: 1
1: 0
2: 2
3: 26
4: 258
Right 990409524 5:55527224-55527246 CTCCTTAGGAGTATCCTTAAGGG 0: 1
1: 0
2: 0
3: 5
4: 84
990409513_990409520 -5 Left 990409513 5:55527179-55527201 CCCCTTTGAGGAAGGGACCCAGA 0: 1
1: 0
2: 2
3: 26
4: 258
Right 990409520 5:55527197-55527219 CCAGATTGAGGCTTAACAAAGGG 0: 1
1: 1
2: 1
3: 9
4: 96
990409513_990409523 21 Left 990409513 5:55527179-55527201 CCCCTTTGAGGAAGGGACCCAGA 0: 1
1: 0
2: 2
3: 26
4: 258
Right 990409523 5:55527223-55527245 GCTCCTTAGGAGTATCCTTAAGG No data
990409513_990409525 23 Left 990409513 5:55527179-55527201 CCCCTTTGAGGAAGGGACCCAGA 0: 1
1: 0
2: 2
3: 26
4: 258
Right 990409525 5:55527225-55527247 TCCTTAGGAGTATCCTTAAGGGG 0: 1
1: 0
2: 0
3: 9
4: 76
990409513_990409518 -6 Left 990409513 5:55527179-55527201 CCCCTTTGAGGAAGGGACCCAGA 0: 1
1: 0
2: 2
3: 26
4: 258
Right 990409518 5:55527196-55527218 CCCAGATTGAGGCTTAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990409513 Original CRISPR TCTGGGTCCCTTCCTCAAAG GGG (reversed) Intronic
900094671 1:935446-935468 TCTCACTCCCTGCCTCAAAGGGG - Intronic
902404933 1:16177428-16177450 TCTGGGGCCCTTGCACACAGGGG - Intergenic
902811843 1:18892478-18892500 TCAGGGTCACCTCCTCAGAGAGG - Intronic
903234734 1:21942450-21942472 ACTGGGTTCCGTTCTCAAAGAGG - Intergenic
904095219 1:27971704-27971726 TGTGGGTCCATTCATCAAGGGGG - Exonic
906247766 1:44289242-44289264 TGGGGGACCCTTCCTTAAAGGGG - Intronic
907480270 1:54740923-54740945 TTTGATTCCCTTCCTCATAGAGG + Intronic
909603088 1:77481041-77481063 TCTGGCTCCCTGCCTCAAGCTGG - Intronic
909896829 1:81081823-81081845 TGAGGGACCATTCCTCAAAGAGG + Intergenic
910364250 1:86447148-86447170 TCTGAGCCCCTTCCCCAAAAAGG - Intronic
910719720 1:90272704-90272726 TGTGGCTCCTTTTCTCAAAGAGG + Intergenic
912145064 1:106783498-106783520 TCTTGGTTCCTTGGTCAAAGTGG - Intergenic
912390430 1:109298807-109298829 TCTGGGTCCCTTCCTCTGCATGG + Intronic
913317880 1:117567632-117567654 CCTGGGTCCCGTCCTCTAGGAGG - Intergenic
915170354 1:153973116-153973138 TCTGGGCCCCTTCCTCACCATGG + Intronic
916705117 1:167341569-167341591 TGTGCTTCCCTTCCTCTAAGAGG - Intronic
917876635 1:179292566-179292588 TCTGGGTCCTTTAAACAAAGTGG - Intergenic
918703658 1:187636038-187636060 CCTGGGTCCCTTCCTCCAAAGGG - Intergenic
920255459 1:204651503-204651525 TGTCAGTCCCTTCCTCAAAGAGG - Intronic
920422980 1:205848390-205848412 CCTGGGTCCCTACATCAATGAGG + Intronic
922025927 1:221748773-221748795 TCTGGATCCATTCCCCAATGTGG - Intergenic
922718778 1:227889864-227889886 TCTGGGGCACTCCCTCCAAGGGG - Intergenic
923564909 1:235069513-235069535 CCTGCGTCCCTTCCTCAGAGAGG - Intergenic
924766390 1:247034880-247034902 GCTGGGTCACTGCCTCAATGTGG + Intergenic
1065591788 10:27269828-27269850 TTTGGGTCTTTTCCTAAAAGTGG + Intergenic
1065658603 10:27980814-27980836 TTTGGGTCTTTTCCTAAAAGTGG - Intronic
1065871908 10:29962993-29963015 CCTGAGTGCCTACCTCAAAGAGG - Intergenic
1065874281 10:29983613-29983635 TCTCTGACCCTTCCTCATAGTGG - Intergenic
1066226959 10:33393140-33393162 ACAGGGTCCCTTCTTCAAAAAGG + Intergenic
1070843245 10:79502689-79502711 TCTGGGTCCCCACCCCACAGAGG + Intergenic
1070992489 10:80744716-80744738 CCTGGATTCCTTCCTCCAAGGGG - Intergenic
1074622484 10:115139613-115139635 ACTGGGTCCCTTCCATAACGTGG + Intronic
1074693012 10:116023961-116023983 TCTGTCCTCCTTCCTCAAAGGGG + Intergenic
1075525060 10:123177297-123177319 TTTGGGTACCATCCTCAAAAAGG - Intergenic
1076855149 10:133112090-133112112 TTAGAGGCCCTTCCTCAAAGTGG - Intronic
1077193263 11:1264995-1265017 CCTGGGTCCCTCCCACAACGTGG + Intergenic
1078437430 11:11337126-11337148 TCTGGGTCTCATCCTCAGAGAGG - Intronic
1080196128 11:29611591-29611613 ACTAGGTTCCTTCCCCAAAGGGG + Intergenic
1080972851 11:37300217-37300239 TCTGGCACCCCTCCTCACAGAGG - Intergenic
1084090223 11:66874877-66874899 TCTGTGTCCCCTCCTCAGAGAGG - Intronic
1084456433 11:69270485-69270507 CCTGGGTCCCCTCCTCCCAGGGG + Intergenic
1084951676 11:72669775-72669797 TGTGGGCCCCTTCCAGAAAGTGG - Intronic
1084982258 11:72836159-72836181 TGTGGGGCCCTTCCCCAAACAGG + Intronic
1086301594 11:85431930-85431952 TCTGGGTTCCTGACTTAAAGGGG - Intronic
1089512222 11:119006771-119006793 ACTGGGTCCCTCCCACAACGTGG - Intronic
1090943477 11:131409397-131409419 TCTGGCTGCCTTCCACAGAGAGG + Intronic
1091511583 12:1132571-1132593 TCTGGGTGCCTTTCATAAAGAGG + Intronic
1092129337 12:6097881-6097903 TCTATGTCCCTTCCTTAATGTGG - Intronic
1092148657 12:6232203-6232225 TCTGGGACCCTGCCTTACAGAGG - Intronic
1092211156 12:6647224-6647246 TCTGGATCGCTTCCTCATGGTGG - Intronic
1094497277 12:30996186-30996208 CCTGGGTCCCTTCCTGGAAGGGG + Exonic
1095048099 12:37532805-37532827 TCTGATTCCATTCCCCAAAGAGG - Intergenic
1095184400 12:39184947-39184969 CCTTGGTTCCATCCTCAAAGTGG + Intergenic
1095413739 12:41952725-41952747 TCTGGATCCCTTCCTCTTTGGGG - Intergenic
1096472536 12:51888599-51888621 TCTGGTTCCCTGCCTGGAAGAGG + Exonic
1097610040 12:61808129-61808151 ACTGGGTCCCTCCCACAACGTGG - Intronic
1098300942 12:69053719-69053741 TCTGGGCCCTTTGCTAAAAGGGG - Intergenic
1098559440 12:71855245-71855267 ACTGGGTTCCTCCCTCAACGTGG + Intronic
1099293874 12:80805756-80805778 CCTGGGTCCCTTCCACAACACGG - Intronic
1099353749 12:81607863-81607885 TCTGGTTCCATTTCTCAAGGGGG + Intronic
1100584502 12:95967264-95967286 ACTGGGTCCCTCCCACAATGTGG + Intronic
1101032727 12:100676266-100676288 ACTGGGTCCCTCCCATAAAGTGG - Intergenic
1102218003 12:111175389-111175411 TTAGGGAACCTTCCTCAAAGTGG + Intronic
1102261898 12:111448030-111448052 TCAGAGTCCCTTCCTCACTGGGG + Exonic
1102984616 12:117268132-117268154 TCTTGGCCACTTCCTGAAAGAGG + Exonic
1104198899 12:126568051-126568073 TCTGGTCCCCTTCCGCACAGTGG + Intergenic
1104554795 12:129789990-129790012 TCCAGTTCCCTTCCGCAAAGGGG - Intronic
1105406630 13:20137497-20137519 TATGGGTCCCTTGCTCACTGCGG - Intergenic
1107550546 13:41470496-41470518 TCTGGGTCCTTTCATCATAAGGG + Exonic
1108054119 13:46468927-46468949 AATGTGTCCTTTCCTCAAAGAGG + Intergenic
1110111064 13:71746764-71746786 TCTGGGTTCCTTCCCAGAAGTGG + Intronic
1111943279 13:94636363-94636385 ACTGGGTCCCTCCCACAACGTGG + Intergenic
1113091111 13:106618324-106618346 ACTGGGTCCCTTCCTGGAAACGG - Intergenic
1116388052 14:44357097-44357119 ACTGGGTCCCTTCCACAACATGG - Intergenic
1118969575 14:70622057-70622079 TCTGTGTCCTTTCCTCTACGTGG + Intergenic
1119711467 14:76825501-76825523 TCTGCATCCCTTCCCCACAGTGG + Intronic
1121473605 14:94174760-94174782 TCTCGGACCCTTCCTCAGAGCGG + Intronic
1121565882 14:94908753-94908775 CCTGGGTCCCTTCCTCACAAGGG + Intergenic
1124239307 15:28016960-28016982 TCTGGGGCCCTTCCTTGCAGGGG - Intronic
1127142406 15:55991583-55991605 TCTCACTCCCTTCCTCAATGTGG + Intronic
1127324170 15:57878801-57878823 TCAGTGTCCCTTCATCAAACTGG + Intergenic
1127356624 15:58207062-58207084 ACTGGGTCCCTTCCATAATGTGG - Intronic
1128306282 15:66600985-66601007 TCTGCTTCCCATCCTCCAAGAGG - Intronic
1128800670 15:70494875-70494897 CCTGGGTCCCTTCCTCCCAGGGG - Intergenic
1129646334 15:77437101-77437123 TATGTGTTCCTTCTTCAAAGAGG + Intronic
1131036436 15:89225493-89225515 TCTTGGGCCCTTCCCCAGAGAGG + Intergenic
1131719583 15:95153221-95153243 ACTGGGTCCCTCCCACAACGTGG - Intergenic
1131845968 15:96491351-96491373 TCGGGTTCCCTTCCTCACTGTGG - Intergenic
1132713134 16:1278126-1278148 TCTGGGGCCCCTCCACCAAGAGG + Intergenic
1133531860 16:6662701-6662723 TCTGGGTCTCTTGGTCAAAAAGG - Intronic
1133781036 16:8939439-8939461 TCTGGGTCCTTTCCAGATAGAGG + Intronic
1134041762 16:11074182-11074204 TCAGGGTGCCTGCCTCAAAGTGG - Intronic
1134182724 16:12060894-12060916 TCTGGGTCCCTTCCAAGAAAGGG - Intronic
1134638557 16:15811088-15811110 TCTGGGTCTCTCCCCCAATGAGG - Intronic
1135417414 16:22279127-22279149 AATGGGCCCCTTCCTCAAGGGGG + Intronic
1138006328 16:53341320-53341342 ACTGTGTTCCTCCCTCAAAGTGG + Intergenic
1138413550 16:56858353-56858375 TCTGGGTCCCTGCCCACAAGGGG - Intergenic
1140288257 16:73625428-73625450 TCTGGGTGCCTTTCTCAATTGGG + Intergenic
1141017380 16:80463396-80463418 TCTGGCTCCCTCCCTGAAACTGG - Intergenic
1141524875 16:84604692-84604714 TCTGGGCCCCTGCCTAACAGAGG - Intronic
1141824995 16:86472566-86472588 CCTGGGTCCTTTCCTCTCAGTGG + Intergenic
1141995520 16:87634514-87634536 TCTGCGTCCCTGCCTCCAGGTGG + Intronic
1142033943 16:87852300-87852322 GCGGGGCCCTTTCCTCAAAGAGG + Intronic
1142678523 17:1531191-1531213 ACTGGGACCCTTCCTCAGTGTGG + Intronic
1143595163 17:7909587-7909609 TCTGTGTCCCCTCCACACAGTGG + Intronic
1145365812 17:22266103-22266125 TCTGACTCCCTTCCCGAAAGAGG - Intergenic
1145366176 17:22268570-22268592 TCTGACTCCCTTCCTGAAAGAGG - Intergenic
1145728673 17:27156280-27156302 TCTGACTCCATTCCTGAAAGAGG + Intergenic
1145998465 17:29117708-29117730 TCTTGTTCCCTTCCTGACAGAGG - Intronic
1146508640 17:33426909-33426931 TATAAGTCGCTTCCTCAAAGAGG - Intronic
1149208767 17:54279457-54279479 TGGGGGTCCCTTCCTCATAAAGG - Intergenic
1149234281 17:54571911-54571933 ACTGGGTCCCTCCCACAACGTGG + Intergenic
1151143646 17:72018861-72018883 TCTGTTTCCCATCTTCAAAGCGG + Intergenic
1151211533 17:72548072-72548094 ACTGGGTCCCTCCCACAATGCGG + Intergenic
1151987402 17:77552847-77552869 TCTGGGCACTTTCCTCAAAAGGG + Intergenic
1152126464 17:78450213-78450235 GCTGGGTGCCTCCCTCAAGGTGG - Intronic
1152480980 17:80552389-80552411 TCTAGGTCCCTTCCTCAGAGAGG + Intronic
1152624142 17:81380508-81380530 TCAGGGTCCCTTCATCTCAGAGG - Intergenic
1152805588 17:82354321-82354343 TGTGGGTCCCTTCCCTAAAAAGG - Intergenic
1153348234 18:4051545-4051567 ACTGGGTCCCTCCCACAATGTGG + Intronic
1155680135 18:28477549-28477571 TCTCAGTCCCTTCATCCAAGAGG - Intergenic
1159124184 18:64204060-64204082 TCTGATTTCCTCCCTCAAAGAGG + Intergenic
1160525454 18:79533008-79533030 TCTGGGTCCCATCCAGACAGGGG + Intergenic
1160928845 19:1560272-1560294 TCAGTTTCCCTTCCTCAAGGAGG - Intronic
1161640725 19:5421041-5421063 TGTGGGGCCCTTTCTCAAAGGGG - Intergenic
1162024392 19:7885419-7885441 CACAGGTCCCTTCCTCAAAGCGG + Intergenic
1162283434 19:9718949-9718971 CCTGGCTCCCTTCCTCCAAGGGG - Intergenic
1164274782 19:23706691-23706713 ACTGGGTCCCTTCCACAAGAGGG - Intergenic
1164595999 19:29530925-29530947 TCTGGGTGCCTTCCTAACAGTGG - Intronic
1164891880 19:31830927-31830949 CCTGGGGACCTTCCTTAAAGAGG - Intergenic
1165324694 19:35107662-35107684 GCTGGTTCCCTTCCTGGAAGGGG - Intergenic
1165562953 19:36696672-36696694 TTTGGGTTCCTTTCTCATAGTGG + Intronic
1166328684 19:42066437-42066459 TCTGGGTCCATTCATCTATGGGG - Intronic
1166523797 19:43498588-43498610 TCTGGGCCCTGTCCTCCAAGTGG + Intronic
1166743521 19:45128948-45128970 TCAGGGTCCCTTCTCCACAGCGG - Intronic
1167229308 19:48271621-48271643 TCTTGACCCCTTCCTCAAAATGG - Intronic
1167597595 19:50435692-50435714 TCTAAGTCCTTTCCCCAAAGCGG + Intronic
1167721492 19:51183059-51183081 TCTGTGTTCCTTTCTCAAGGCGG - Intergenic
1167763485 19:51463711-51463733 TCTGTGTTCCTTTCTCAAGGCGG + Intergenic
925874016 2:8296790-8296812 TCTGCCTTCCTTCCTTAAAGAGG - Intergenic
927361470 2:22239541-22239563 TCTTGTTCCCTCCCTTAAAGAGG + Intergenic
927859514 2:26551603-26551625 TGTGGTTCCTGTCCTCAAAGGGG - Intronic
929854544 2:45625597-45625619 TCTGGGCCCCTTTCTCACATGGG - Intergenic
930029107 2:47047596-47047618 CCTGGCTCCCTTCCTGCAAGGGG + Intronic
930057822 2:47265474-47265496 TCTGGGTCCTTTCCCCCATGTGG + Intergenic
930369689 2:50487374-50487396 TCTGTGTCCATTCTTAAAAGTGG - Intronic
932908239 2:75777717-75777739 TCAGTGTCTTTTCCTCAAAGAGG + Intergenic
933675348 2:85051303-85051325 TCTAAGTCCCTACCTCAAAAAGG + Intronic
934619235 2:95793958-95793980 CCTGGGACCCTTCCTTAAGGAGG + Intergenic
936907325 2:117551961-117551983 CCTTGGTCCCTCCCTCTAAGAGG + Intergenic
942388803 2:175470379-175470401 CCTGGGTCCCTAACTCAAAATGG + Intergenic
947429160 2:230010545-230010567 TCTGGCTGTTTTCCTCAAAGAGG + Intronic
947757928 2:232581820-232581842 TTTGCTTCCCTTCCTCAATGAGG - Intronic
1171148116 20:22803444-22803466 TCTGAGTCCCTTCCACACATGGG - Intergenic
1171798418 20:29584248-29584270 TCTGATTCCTTTCCCCAAAGAGG + Intergenic
1171845677 20:30272925-30272947 TCTGATTCCATTCCCCAAAGAGG - Intergenic
1172888427 20:38247001-38247023 TCTGGATCCCTTCCTGGAAGAGG - Intronic
1172944307 20:38675479-38675501 TCAGCGTCCCTTCCTCTGAGAGG + Intergenic
1173945366 20:46946059-46946081 TCTGGGTCCCTTTCCCAGTGGGG + Intronic
1177272583 21:18868999-18869021 TTTGGGTGCTTTTCTCAAAGAGG - Intergenic
1179823117 21:43948436-43948458 CCTGGATCACTTGCTCAAAGAGG + Intronic
1180036167 21:45251409-45251431 TCTGGGTTCCTGCCTCACACAGG + Intergenic
1181772924 22:25139760-25139782 TCTATGTTCCCTCCTCAAAGAGG - Intronic
1182878797 22:33715429-33715451 CCTGGGTGACTTTCTCAAAGTGG + Intronic
1183087684 22:35496749-35496771 TCTGTGGCTATTCCTCAAAGTGG - Intergenic
1183331160 22:37222332-37222354 TCCTTGTCCCTTCTTCAAAGCGG - Intergenic
1183830904 22:40417966-40417988 TCAGGGTCCTCTCCTCAGAGAGG - Intronic
1184466155 22:44669695-44669717 ACTGGGTCACTTCCTCCAAGCGG + Intronic
949289213 3:2444359-2444381 TCTGCATCCCTTCCTCAGAGAGG - Intronic
950152318 3:10697282-10697304 GCTGGCTCCCTTCTGCAAAGGGG - Intronic
950501674 3:13367872-13367894 TCTGGGTGCCTTCCTCTTGGGGG + Intronic
951604352 3:24416276-24416298 TCTGTGTGCCTTCCTGATAGCGG - Intronic
952996497 3:38888056-38888078 TCTGGTTCCCTTCCTCATCTAGG - Intronic
954408313 3:50357842-50357864 TCCCTGTCCCTTCCTCACAGGGG + Intronic
956671280 3:71693375-71693397 TCTCTGTCCCCTGCTCAAAGAGG - Intronic
957834619 3:85571292-85571314 TATGAGTCCTTTCCTCAAAATGG + Intronic
959082910 3:101821438-101821460 TGTGGGTCCCTTCCTTGCAGTGG + Exonic
959215320 3:103444961-103444983 ACTGGGTCCCTCCCACAATGTGG - Intergenic
959468882 3:106724129-106724151 ACTGGGTCCCTTGCTCAATACGG - Intergenic
960702447 3:120451240-120451262 CGTGGGTCCCTGCCACAAAGGGG + Exonic
961867200 3:129962221-129962243 TTTGGGTCACTTCCCCAATGGGG + Intergenic
962118817 3:132540871-132540893 TCTGAGCCCATTCCTCAAAGGGG + Intergenic
962339642 3:134571052-134571074 ACTGGGTCCCTCCCACAACGTGG + Intronic
966209171 3:177435006-177435028 TTCCGGTCCCTTCCTCAAGGAGG + Intergenic
967117752 3:186356974-186356996 TCTGGGTTCTTTCCTCGCAGAGG + Intronic
967118060 3:186360054-186360076 TCTGGGTTCTTTCCTCGCAGAGG + Intronic
968591843 4:1463473-1463495 TCCAAGTCACTTCCTCAAAGTGG + Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
973019613 4:45186347-45186369 TATAGGTCACTTCCTAAAAGTGG - Intergenic
973121214 4:46522712-46522734 AGTGGGCTCCTTCCTCAAAGAGG + Intergenic
974564593 4:63566845-63566867 AGTGGGTTCCTTCCTCAAGGGGG - Intergenic
977513939 4:97996409-97996431 ACTGGATCCCTTCCTTAAACTGG + Intronic
978311037 4:107385234-107385256 CCTGGATTCCTTCCTCCAAGGGG - Intergenic
979688895 4:123540078-123540100 TCAGGGCTTCTTCCTCAAAGAGG + Intergenic
981910951 4:149981317-149981339 TCTTTGTCCCTTCCCCAGAGAGG - Intergenic
982127134 4:152193794-152193816 TCTGAGTCCCTCTCTGAAAGTGG - Intergenic
983014730 4:162599498-162599520 CCTGGGACCCTTCCACAACGTGG - Intergenic
984886195 4:184451927-184451949 TCTGGGACTCTTCCTAAAAGAGG + Intronic
985045040 4:185932131-185932153 TTGGGGCCCCTTCCTCCAAGTGG - Intronic
985844801 5:2336276-2336298 TGTGGGTTCCTTCCTCTAACAGG + Intergenic
987121583 5:14772951-14772973 TCAGTGTCCCTGCCTCCAAGTGG + Intronic
990409513 5:55527179-55527201 TCTGGGTCCCTTCCTCAAAGGGG - Intronic
991671148 5:69049059-69049081 TCAGGGTCCCTTGCACATAGTGG - Intergenic
996422328 5:123276593-123276615 TCTGGTTTCCCTCTTCAAAGTGG - Intergenic
997420909 5:133766032-133766054 TATGGGTCCCCTCCTCAGTGTGG - Intergenic
997612512 5:135224997-135225019 TCTTGTACCCTTCCTCCAAGGGG + Intronic
997670340 5:135666203-135666225 TCAGTGTCCCATCCACAAAGTGG + Intergenic
998785975 5:145709257-145709279 TATGGGTCCCTTCCTAAGAGAGG - Intronic
1000944315 5:167401607-167401629 TCTGAGTAACTCCCTCAAAGAGG - Intronic
1001131298 5:169065779-169065801 TCTCTGTCCCTTCAGCAAAGAGG + Intronic
1002313865 5:178330891-178330913 TCAGTGTCACTTCATCAAAGAGG + Intronic
1003338985 6:5201693-5201715 TGTGGGTGCCTTCCCCAGAGAGG + Intronic
1003698637 6:8438045-8438067 TCTGGGGCCCTTCAACCAAGGGG + Intergenic
1004025063 6:11810289-11810311 CCTGGGTCCCTTCCTCAGAGGGG + Intergenic
1004718753 6:18245828-18245850 ACTGGGTCCCTCCCACAACGTGG - Intronic
1006298659 6:33181426-33181448 TCTGGGGACCTTCCTGAAAGAGG - Intronic
1008284183 6:49628906-49628928 TCTGGTCCCCTTCCACAATGTGG - Intronic
1009628362 6:66164882-66164904 CCTGGATCCCTTCCCCAGAGGGG + Intergenic
1012001400 6:93659520-93659542 TCTAGGGTCTTTCCTCAAAGAGG - Intergenic
1016639537 6:146333254-146333276 TCTGAGACCCTTCCTCATATGGG + Intronic
1019935595 7:4255353-4255375 TCTGTGTCACTGCATCAAAGTGG + Intronic
1020490939 7:8783348-8783370 TCATGGTCCCTTTCTTAAAGAGG + Intergenic
1020745292 7:12072041-12072063 CCTGGGCTCCTTCCCCAAAGGGG - Intergenic
1023804810 7:43865046-43865068 ACTGGGTCCCTCCCACAACGTGG - Intergenic
1024086398 7:45895038-45895060 ACTGGGGCCCTTTCTCAAGGGGG + Intergenic
1024593728 7:50914528-50914550 TCTGACTCACTTCATCAAAGGGG - Intergenic
1025294015 7:57761375-57761397 TCTGATTCCATTCCCCAAAGAGG - Intergenic
1025810033 7:64869818-64869840 TCTGACTCCTTTCCCCAAAGAGG - Intergenic
1025810881 7:64874782-64874804 TCTGATTCCATTCCTGAAAGAGG - Intronic
1027184228 7:75960756-75960778 TCTGGGTCCCTACCTTAGTGCGG + Intronic
1027190915 7:75994946-75994968 TCTAACTCCCTTCCCCAAAGAGG - Intergenic
1029708059 7:102285954-102285976 TCTGGGAGGCTTCCTGAAAGAGG - Intronic
1030443439 7:109618657-109618679 TCTGAGTTCCTTCCTCAAGAAGG - Intergenic
1032780638 7:135162687-135162709 ACTGGGTCCCTCCCACAATGTGG + Intronic
1033113682 7:138606330-138606352 TCTGGGTCCCCTCTCCACAGTGG - Intronic
1036614600 8:10378631-10378653 TCCGCGTCCCTTCTTCACAGAGG + Intronic
1038401700 8:27288905-27288927 ACTTGGTCCCTTCTTCAGAGAGG - Intronic
1039491327 8:37949669-37949691 TCTTGGTGCCTTCCTCACAGTGG + Intergenic
1040690524 8:49932124-49932146 TCTGTGTCTCTTCCACAAAAGGG - Intronic
1041765495 8:61414125-61414147 TCTGGCTTCCTGCCCCAAAGTGG + Intronic
1044562576 8:93627476-93627498 TCCATGTCCCTTCCTCAAAGAGG + Intergenic
1046809501 8:118517134-118517156 TCTGAGTTCCTAGCTCAAAGGGG + Intronic
1048713472 8:137240422-137240444 TCAGCGTCCCCTCCTCTAAGAGG + Intergenic
1050480710 9:6084522-6084544 CCTGGATTCCTTCCTCCAAGGGG - Intergenic
1051211251 9:14746976-14746998 TCTGGATGCCTTCTTCAAAATGG + Exonic
1054162096 9:61680817-61680839 TCTGAGTCCATTCCCAAAAGAGG + Intergenic
1054162402 9:61682921-61682943 TCTGATTCCATTCCCCAAAGAGG + Intergenic
1056110457 9:83389557-83389579 TCTGGGTCACTCCCTGAAAATGG + Intronic
1062547859 9:137071648-137071670 TCTGGGTCACTCACTCTAAGTGG + Intergenic
1203656213 Un_KI270752v1:27326-27348 ACTGGGCCACTTCCTCACAGGGG - Intergenic
1185835161 X:3339158-3339180 TTTGGGTGCCTTCCTGAAAGGGG - Intronic
1188867607 X:35332786-35332808 ACTGGATCCCTTCCTCAAGATGG - Intergenic
1190222193 X:48519436-48519458 ACTGTGTCACTTCCTCATAGTGG - Intronic
1191269367 X:58443342-58443364 TTTTGGTCCATTCCGCAAAGAGG - Intergenic
1191641117 X:63430554-63430576 TGTGGGTTCCTTCCGCAAAGGGG + Intergenic
1193278884 X:79624950-79624972 TCTGGGTCCCGTCATCAATGTGG - Intergenic
1194803268 X:98297404-98297426 TCAGGCTCCTTTCATCAAAGTGG + Intergenic
1196929438 X:120666539-120666561 TCTCTCTCCCTACCTCAAAGTGG - Intergenic
1198225500 X:134641497-134641519 TCATGATGCCTTCCTCAAAGAGG + Intronic
1199113147 X:143958670-143958692 CCTGGGTCCCTTCCACAACATGG + Intergenic
1200696885 Y:6368905-6368927 TCTGACTCCATTCCTGAAAGAGG + Intergenic
1200697486 Y:6373821-6373843 TCTGATTCCATTCCTGAAAGAGG + Intergenic
1200701520 Y:6406554-6406576 TCTGACTCCATTCCTGAAAGAGG + Intergenic
1200703725 Y:6423821-6423843 TCTGACTCCATTCCTGAAAGGGG + Intergenic
1200912818 Y:8546169-8546191 TCTGATTCCATTCCTGAAAGTGG - Intergenic
1200920634 Y:8609902-8609924 TCTGACTCCATTCCTAAAAGAGG - Intergenic
1200921260 Y:8615446-8615468 TCTGACTCCATTCCTGAAAGAGG - Intergenic
1200921866 Y:8620396-8620418 TCTGACTCCATTCCTGAAAGAGG - Intergenic
1200926335 Y:8658258-8658280 TCTGACTCCATTCCTGAAAGGGG - Intergenic
1200933672 Y:8719858-8719880 TCTGACTCCATTCCTGAAAGAGG + Intergenic
1200933977 Y:8722261-8722283 TCTGACTCCATTCCTGAAAGAGG + Intergenic
1200934275 Y:8724627-8724649 TCTGACTCCATTCCTGAAAGAGG + Intergenic
1200938437 Y:8758726-8758748 TCTGGCTCCATTCCAGAAAGAGG + Intergenic
1200960772 Y:8993935-8993957 TCTGACTCCATTCCTGAAAGAGG - Intergenic
1200962544 Y:9008584-9008606 TCTGGCTCTATTCCTGAAAGAGG - Intergenic
1201030386 Y:9740886-9740908 TCTGACTCCATTCCTGAAAGGGG - Intergenic
1201032591 Y:9758144-9758166 TCTGACTCCATTCCTGAAAGAGG - Intergenic
1201036627 Y:9790878-9790900 TCTGATTCCATTCCTGAAAGAGG - Intergenic
1201037228 Y:9795794-9795816 TCTGACTCCATTCCTGAAAGAGG - Intergenic
1202129057 Y:21593805-21593827 TCTGGCTCTATTCCTGAAAGAGG - Intergenic
1202176302 Y:22102000-22102022 TCTGGCTCCATTCGTGAAAGAGG + Intergenic
1202178197 Y:22116929-22116951 TCTGACTCCATTCCTGAAAGAGG + Intergenic
1202213164 Y:22469466-22469488 TCTGACTCCATTCCTGAAAGAGG - Intergenic
1202215059 Y:22484384-22484406 TCTGGCTCCATTCGTGAAAGAGG - Intergenic
1202247620 Y:22835919-22835941 TCCAGGGCCATTCCTCAAAGAGG + Intergenic
1202400608 Y:24469667-24469689 TCCAGGGCCATTCCTCAAAGAGG + Intergenic
1202470172 Y:25200419-25200441 TCCAGGGCCATTCCTCAAAGAGG - Intergenic