ID: 990416397

View in Genome Browser
Species Human (GRCh38)
Location 5:55591118-55591140
Sequence TTGTGCCAATGAGATATCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990416390_990416397 9 Left 990416390 5:55591086-55591108 CCCCCTTTCTCGCCAGGGGTCAG No data
Right 990416397 5:55591118-55591140 TTGTGCCAATGAGATATCAGGGG No data
990416393_990416397 6 Left 990416393 5:55591089-55591111 CCTTTCTCGCCAGGGGTCAGTTC No data
Right 990416397 5:55591118-55591140 TTGTGCCAATGAGATATCAGGGG No data
990416394_990416397 -3 Left 990416394 5:55591098-55591120 CCAGGGGTCAGTTCAGAAATTTG No data
Right 990416397 5:55591118-55591140 TTGTGCCAATGAGATATCAGGGG No data
990416391_990416397 8 Left 990416391 5:55591087-55591109 CCCCTTTCTCGCCAGGGGTCAGT No data
Right 990416397 5:55591118-55591140 TTGTGCCAATGAGATATCAGGGG No data
990416392_990416397 7 Left 990416392 5:55591088-55591110 CCCTTTCTCGCCAGGGGTCAGTT No data
Right 990416397 5:55591118-55591140 TTGTGCCAATGAGATATCAGGGG No data
990416386_990416397 29 Left 990416386 5:55591066-55591088 CCAAGACACTTAGGATAACTCCC No data
Right 990416397 5:55591118-55591140 TTGTGCCAATGAGATATCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990416397 Original CRISPR TTGTGCCAATGAGATATCAG GGG Intergenic
No off target data available for this crispr