ID: 990417137

View in Genome Browser
Species Human (GRCh38)
Location 5:55597350-55597372
Sequence TGCCAAAGGATGACAAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990417135_990417137 -5 Left 990417135 5:55597332-55597354 CCAGAAAACTTGGGAAAATGCCA No data
Right 990417137 5:55597350-55597372 TGCCAAAGGATGACAAAGCCAGG No data
990417132_990417137 5 Left 990417132 5:55597322-55597344 CCTTTAAGGACCAGAAAACTTGG No data
Right 990417137 5:55597350-55597372 TGCCAAAGGATGACAAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990417137 Original CRISPR TGCCAAAGGATGACAAAGCC AGG Intergenic
No off target data available for this crispr