ID: 990418497

View in Genome Browser
Species Human (GRCh38)
Location 5:55609155-55609177
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990418497_990418501 -9 Left 990418497 5:55609155-55609177 CCTGAAGCTGGAAAGCCCCTCAG No data
Right 990418501 5:55609169-55609191 GCCCCTCAGGAGGAGTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990418497 Original CRISPR CTGAGGGGCTTTCCAGCTTC AGG (reversed) Intergenic
No off target data available for this crispr