ID: 990428091

View in Genome Browser
Species Human (GRCh38)
Location 5:55708878-55708900
Sequence ATCTGTCAGCAGGCCAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990428089_990428091 3 Left 990428089 5:55708852-55708874 CCAATAGAACTTTATGAAAAAAA 0: 1
1: 0
2: 15
3: 193
4: 2505
Right 990428091 5:55708878-55708900 ATCTGTCAGCAGGCCAAATTTGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990428091 Original CRISPR ATCTGTCAGCAGGCCAAATT TGG Intronic
900739841 1:4324058-4324080 ATTTGAAATCAGGCCAAATTAGG - Intergenic
905044648 1:34986027-34986049 ATCAGACATCTGGCCAAATTTGG - Intronic
908004702 1:59715847-59715869 AACAGTCAGTAGGCAAAATTTGG - Intronic
912572705 1:110636174-110636196 ATCAGTCATCAGCACAAATTGGG + Intergenic
914756518 1:150564808-150564830 AACAGGCAGCAGGGCAAATTTGG + Intergenic
916925663 1:169517977-169517999 AACAGGCAGCGGGCCAAATTTGG - Intronic
919400343 1:197107966-197107988 GTATATCTGCAGGCCAAATTTGG - Intronic
920295347 1:204952854-204952876 GTCTGTCAGCAGGAGAAATGAGG + Intronic
921359397 1:214316617-214316639 ATCTGTCCCCAGACCAAGTTAGG + Intronic
922251341 1:223851388-223851410 AACAGGCAGAAGGCCAAATTTGG - Intergenic
922420093 1:225453824-225453846 ATCTGGCAGCAGTGCAACTTTGG + Intergenic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1062998484 10:1891456-1891478 TTGTGTCAGGAGGCCAATTTGGG + Intergenic
1064433295 10:15289736-15289758 AGCAGGCAGCAGGCCACATTTGG - Intronic
1067981164 10:51086666-51086688 ACCTGTCTGCACACCAAATTTGG - Intronic
1068533542 10:58215097-58215119 ATCTGTCAGAAGGCTAGCTTGGG - Intronic
1068931487 10:62594848-62594870 AACTGACAGTAGGTCAAATTTGG + Intronic
1069811086 10:71160289-71160311 ATCTGTCAGTTGGCCTCATTAGG - Intergenic
1070196188 10:74159339-74159361 TTTTGTCAGCAAGCCACATTTGG + Intronic
1070750103 10:78959010-78959032 AACTCTCAGCAGGACACATTAGG + Intergenic
1072283636 10:93893289-93893311 ATCTTACATCTGGCCAAATTAGG + Intergenic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072815643 10:98506397-98506419 ATCTGCCAACAGGACAAGTTTGG - Intronic
1073597683 10:104817252-104817274 ATGTGTCAGCAGCCCTTATTAGG - Intronic
1074707846 10:116151402-116151424 ACCTGTTAGAAGGCCAAATGGGG + Intronic
1074922793 10:118034169-118034191 AACTGGCAGCAAGCCAGATTTGG + Intronic
1088644248 11:111904045-111904067 TTCGGTCAGCAGGCCAAGTGTGG + Intergenic
1089791699 11:120949854-120949876 ATCTGTCAGTATGGAAAATTGGG + Intronic
1090686930 11:129131883-129131905 ACCTGACAGCAGCCCAAATCAGG + Intronic
1091733499 12:2899401-2899423 AACTGACGGCAGGCCAGATTTGG + Intronic
1093934859 12:24989841-24989863 ATATGTTAGCAGACCAAATGTGG - Intergenic
1094179360 12:27575278-27575300 GTCTGTAAGAAGGCCAAATGTGG - Intronic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1096849688 12:54427651-54427673 ATCTGTCAATAGGCTAAAGTTGG + Intergenic
1097276468 12:57816864-57816886 ATCTGTCCGCAGGCCAGACCAGG - Intronic
1098905092 12:76153721-76153743 ATCTTTCAGCATGCCAGTTTGGG + Intergenic
1102033104 12:109754620-109754642 AGCAGCCAGCAGGCCAGATTTGG + Intronic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1104492065 12:129202761-129202783 CTCTGTCAGCAGGGCATACTGGG + Intronic
1105582813 13:21716653-21716675 GACTGTCAGGAGGCTAAATTAGG + Intergenic
1109286427 13:60414290-60414312 AACTGGTAGCAGGCCAGATTTGG - Intronic
1112874422 13:104017935-104017957 ATATTTCAGCAGGCCAAAGCAGG + Intergenic
1113985459 13:114311877-114311899 ACCTTTCAAAAGGCCAAATTGGG + Intergenic
1114292259 14:21298107-21298129 GTCTGTAAGCAGACAAAATTAGG + Intronic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1116277360 14:42852760-42852782 AACTGGCAGCAGTCCAGATTTGG + Intergenic
1116995471 14:51319293-51319315 AACAGTCAGCAAGCCAGATTAGG - Intergenic
1117697636 14:58382211-58382233 ATCTGTCACAAGGTAAAATTTGG + Intergenic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1120242847 14:81970075-81970097 ATGTGTCAAGAGGCCAAAGTAGG + Intergenic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1125635865 15:41188238-41188260 AACAGTCTGCAGGCCAGATTTGG + Intronic
1125839630 15:42787108-42787130 ATAGGTAAGCAGGCCAGATTTGG - Intronic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1129938131 15:79467906-79467928 ATCTGTAAGCAAGCAAAATGGGG - Intronic
1130404032 15:83581981-83582003 ATTTCTCACCAGGCCAAGTTGGG + Intronic
1130626182 15:85517810-85517832 ATCTGTCAGCAAAACTAATTAGG + Intronic
1130675663 15:85949816-85949838 ATGTGTCCACAGGCCAAATGCGG + Intergenic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1132165166 15:99579932-99579954 TTCTGGCAGCAGGCAAAAATGGG - Intronic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1135199281 16:20422810-20422832 TTCTGTCAGCAAGCCTTATTGGG - Intronic
1139219640 16:65168095-65168117 ATCTGTCATCAGAGCATATTGGG - Intergenic
1140882442 16:79211128-79211150 ATCTGGCAGCAGCCCCACTTGGG + Intronic
1143041199 17:4038288-4038310 ATCTGAATGCAGGCCAAACTTGG - Intronic
1149786900 17:59443331-59443353 AACAGGCAGCAGTCCAAATTTGG + Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1155285481 18:24284352-24284374 TTCTTACAGCAGGCCAAATAAGG - Intronic
1156725541 18:40121865-40121887 ATCTGTCATCAGGGCAAATTGGG + Intergenic
1156753467 18:40490740-40490762 AACTGACAGCCGGCCAGATTTGG + Intergenic
1157161249 18:45316207-45316229 ATCTCTCAGCAGGCTAATGTGGG + Intronic
1157901739 18:51524594-51524616 AACAGACAGCAGGCCCAATTTGG - Intergenic
1159489133 18:69106885-69106907 ATCAGTCTGCAGACCATATTTGG + Intergenic
1162117821 19:8442204-8442226 ATCTTTCCTCAGGCCAACTTTGG + Intronic
1163646457 19:18492208-18492230 CTCTGTGAGGAGGCCACATTCGG + Intronic
1166527545 19:43522048-43522070 AACTGATGGCAGGCCAAATTTGG - Intronic
926276440 2:11406667-11406689 AATTGTCAGCAGGCTATATTTGG + Intergenic
929209879 2:39344290-39344312 ATCAGGCAGCAGGCTAGATTTGG - Intronic
932375796 2:71234709-71234731 AGCTGTCAGCTGGCCGGATTTGG + Intergenic
932722897 2:74150887-74150909 ATCTGTCAGCAGCCCAATATGGG + Intergenic
932809744 2:74814767-74814789 ATCTGGCTGCAGGTAAAATTTGG - Intergenic
934648806 2:96075576-96075598 AGCAGGCAGCAGGTCAAATTTGG + Intergenic
940413724 2:153396077-153396099 ATCAGGCAGCAGGCTAAATTTGG + Intergenic
941016663 2:160365160-160365182 AACTCTCAGCAAGTCAAATTTGG + Intronic
941492417 2:166158724-166158746 CTCTGTCAGCAGGCTTAATTAGG + Intergenic
942040732 2:172059675-172059697 AACAGTCAGCAGTCCAGATTTGG + Intronic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
945712196 2:213312022-213312044 ATCAGGAAGCAGGCCAGATTTGG - Intronic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1170457259 20:16544713-16544735 ATCAGTAAGCAGGTCAAATGTGG - Intronic
1171031748 20:21682713-21682735 TTCTGGAAGGAGGCCAAATTTGG + Intergenic
1172343763 20:34180334-34180356 ATCAGCAAGCAGGCCAAATCTGG + Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1178617507 21:34146635-34146657 GCCTGTAAGCAGGCCAAAATGGG - Intergenic
1178926211 21:36777406-36777428 AACTGGCAGCAGGCCAGACTCGG + Intronic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182612662 22:31562121-31562143 AACAGAAAGCAGGCCAAATTTGG - Intronic
949975985 3:9459818-9459840 ATTTGTTAGCAGGTCAAATGGGG + Intronic
950479636 3:13236496-13236518 ATGTGTTAGCAGGACAAGTTTGG - Intergenic
951258180 3:20475373-20475395 AACTGTCAGCAGACCAGATTAGG + Intergenic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
952570721 3:34712659-34712681 AGCTGTCAGCAGGCAGAATAAGG + Intergenic
955887570 3:63617460-63617482 ATCTGTCTGAAGGCCTAATCAGG + Intergenic
956212067 3:66812302-66812324 AACAGGCAGCAGGCCAAGTTTGG + Intergenic
956686412 3:71832691-71832713 AACTGGCAGCAGGCTAGATTTGG - Intergenic
956732926 3:72213454-72213476 AACAGGCTGCAGGCCAAATTCGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
959378472 3:105613463-105613485 ATCTCTCACCAGGCCTAATCAGG + Intergenic
961082594 3:124039029-124039051 ATGTGTCTGCAGGTCCAATTTGG - Intergenic
963321640 3:143815209-143815231 ATCTGTGGACTGGCCAAATTAGG + Intronic
973208558 4:47588406-47588428 ATCAGACAGTAGGCCAAATTTGG - Intronic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
976901613 4:90184300-90184322 ATCTGTCAGCAGCCCCTGTTGGG + Intronic
981406155 4:144372095-144372117 ATGTTTTAGCAGGCCAAATGAGG - Intergenic
981484933 4:145276030-145276052 ATATGTCTGCAGGCCTGATTTGG - Intergenic
986362872 5:6998728-6998750 ACCAATCAGCAGGCCAAATAAGG + Intergenic
988434977 5:31163645-31163667 ATGTCTCAGCAGGTCAAAGTTGG + Intergenic
988530296 5:32021586-32021608 CTCTGTCAGGAGGCCAGATGCGG - Intronic
990428091 5:55708878-55708900 ATCTGTCAGCAGGCCAAATTTGG + Intronic
990433591 5:55764248-55764270 AGATGGCAACAGGCCAAATTAGG - Intronic
991098313 5:62762934-62762956 AAATGTCAGCAGGCTACATTTGG - Intergenic
991578268 5:68127357-68127379 ATCTGGAGCCAGGCCAAATTTGG + Intergenic
991936740 5:71809645-71809667 ATGAGTCAGCAGGCCCAAATGGG + Intergenic
994771909 5:103992341-103992363 ATCTTTCAGCAGAACAAATCCGG - Intergenic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1000962283 5:167614275-167614297 ATCTGTCTGCAAGCCATTTTTGG + Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1002126912 5:177052523-177052545 ACCTGTCTGCAAGCCAGATTTGG + Intronic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1005599946 6:27416418-27416440 ATCTGTTACCAGGGCAGATTTGG + Intergenic
1008250541 6:49234055-49234077 ATCTGTCAGTGTGCCAAATAGGG + Intergenic
1009276104 6:61682497-61682519 AACAATCAGCTGGCCAAATTTGG - Intronic
1011696268 6:89916212-89916234 AACTGCCAGCAGGCCAAGTGCGG - Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013336005 6:109162418-109162440 ATATGTAAGAAGGCCAAAGTCGG - Intronic
1014663475 6:124203677-124203699 TGCTGTCAGCAGGCCTAACTTGG - Intronic
1015245090 6:131065868-131065890 CTCTGTCACCTGGCCAACTTTGG + Intergenic
1015778930 6:136843401-136843423 ATCTAACTGCAGGCCAGATTTGG - Intronic
1020124602 7:5526526-5526548 AGCTGTCTGCAGGCCAGATATGG + Intergenic
1023291946 7:38678084-38678106 AACTGTCCACAGGCCAAAATTGG + Intergenic
1024804130 7:53116697-53116719 ATATGTCAGCAGCCCAAAAAAGG + Intergenic
1025797649 7:64754820-64754842 ATTTTTCAGCAGGCTAAAATGGG - Intergenic
1026191542 7:68133036-68133058 CTCTATCATCAGGCCACATTGGG - Intergenic
1030104037 7:105971653-105971675 AGCTATCAGCAGGCAATATTTGG + Intronic
1031490125 7:122377055-122377077 ATTTGACAGCAGGAGAAATTAGG + Intronic
1031865058 7:127029785-127029807 ATCTCTCAGCCTGGCAAATTGGG - Intronic
1032058596 7:128704697-128704719 ATCTGACAGGAGGCCGAACTTGG + Intergenic
1032451574 7:132036211-132036233 ACCTGTCAGCAGGCTCAATCTGG + Intergenic
1032688791 7:134261897-134261919 ATCTGGCTGCAGGCCCGATTTGG + Intronic
1037303748 8:17482628-17482650 TTGTGTCAGCTAGCCAAATTGGG + Intergenic
1038720816 8:30033887-30033909 ATCACTCAGCAGGCCACCTTAGG + Intergenic
1040725245 8:50375054-50375076 ATGTGTCTGCAGGCTAGATTTGG + Intronic
1041702597 8:60807912-60807934 GTTTGGCAGAAGGCCAAATTTGG + Intronic
1042064448 8:64858614-64858636 AGCTGTCACCAGGCTAAAATGGG + Intergenic
1042396899 8:68302807-68302829 ATTTGTGAGAAGGCAAAATTTGG + Intergenic
1044711460 8:95062424-95062446 ATATGCCTGCAGGCCTAATTTGG - Intronic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1047414019 8:124649109-124649131 CTATGGCAGCAGGCCAAATCCGG + Intronic
1049915567 9:314540-314562 ATCTGGGAGCAGGCCTAATGGGG + Intronic
1051200576 9:14617128-14617150 TTCTGTCACCAGGCCAAATGTGG + Exonic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1052726863 9:32239066-32239088 GTCAGACAGCTGGCCAAATTTGG - Intergenic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1056255491 9:84795220-84795242 ACCTGGCAGCAGGACAAAGTAGG - Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1186706342 X:12143264-12143286 AACAGTCAGCAAGCCAGATTTGG - Intronic
1187502666 X:19852706-19852728 ATATGAAACCAGGCCAAATTAGG + Intronic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1188644208 X:32544078-32544100 AACTGGCAGCATGCTAAATTTGG + Intronic
1188959950 X:36479101-36479123 TTCTGCCAGCAGGCCAAACCAGG + Intergenic
1192475047 X:71433686-71433708 ATCTATCTGCAGGCCAAATCTGG + Intronic
1194755799 X:97737814-97737836 ATATGTCAGGAGGCCGATTTAGG - Intergenic
1195222773 X:102762316-102762338 ATCTTCTAGCAGGCCAATTTTGG + Intergenic
1195287309 X:103397661-103397683 ATCTTCTAGCAGGCCAATTTTGG + Intergenic