ID: 990438704

View in Genome Browser
Species Human (GRCh38)
Location 5:55821957-55821979
Sequence ACGCTCTCCCAGCCAGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990438689_990438704 29 Left 990438689 5:55821905-55821927 CCCGAGCTCGCGGAGGCGGGCTT No data
Right 990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG No data
990438699_990438704 -10 Left 990438699 5:55821944-55821966 CCCGGTGGTCCTGACGCTCTCCC No data
Right 990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG No data
990438698_990438704 -5 Left 990438698 5:55821939-55821961 CCTGACCCGGTGGTCCTGACGCT No data
Right 990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG No data
990438690_990438704 28 Left 990438690 5:55821906-55821928 CCGAGCTCGCGGAGGCGGGCTTC No data
Right 990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG No data
990438695_990438704 6 Left 990438695 5:55821928-55821950 CCACGGGCGGCCCTGACCCGGTG No data
Right 990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG No data
990438697_990438704 -4 Left 990438697 5:55821938-55821960 CCCTGACCCGGTGGTCCTGACGC No data
Right 990438704 5:55821957-55821979 ACGCTCTCCCAGCCAGCGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990438704 Original CRISPR ACGCTCTCCCAGCCAGCGGC GGG Intergenic
No off target data available for this crispr