ID: 990439635

View in Genome Browser
Species Human (GRCh38)
Location 5:55831930-55831952
Sequence CTATAGATACAACCTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990439635_990439636 25 Left 990439635 5:55831930-55831952 CCACTCTCAGGTTGTATCTATAG No data
Right 990439636 5:55831978-55832000 TGTATCCCTTGTCCCAGCTTTGG No data
990439635_990439638 27 Left 990439635 5:55831930-55831952 CCACTCTCAGGTTGTATCTATAG No data
Right 990439638 5:55831980-55832002 TATCCCTTGTCCCAGCTTTGGGG No data
990439635_990439637 26 Left 990439635 5:55831930-55831952 CCACTCTCAGGTTGTATCTATAG No data
Right 990439637 5:55831979-55832001 GTATCCCTTGTCCCAGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990439635 Original CRISPR CTATAGATACAACCTGAGAG TGG (reversed) Intergenic
No off target data available for this crispr