ID: 990439635 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:55831930-55831952 |
| Sequence | CTATAGATACAACCTGAGAG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 990439635_990439636 | 25 | Left | 990439635 | 5:55831930-55831952 | CCACTCTCAGGTTGTATCTATAG | No data | ||
| Right | 990439636 | 5:55831978-55832000 | TGTATCCCTTGTCCCAGCTTTGG | No data | ||||
| 990439635_990439638 | 27 | Left | 990439635 | 5:55831930-55831952 | CCACTCTCAGGTTGTATCTATAG | No data | ||
| Right | 990439638 | 5:55831980-55832002 | TATCCCTTGTCCCAGCTTTGGGG | No data | ||||
| 990439635_990439637 | 26 | Left | 990439635 | 5:55831930-55831952 | CCACTCTCAGGTTGTATCTATAG | No data | ||
| Right | 990439637 | 5:55831979-55832001 | GTATCCCTTGTCCCAGCTTTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 990439635 | Original CRISPR | CTATAGATACAACCTGAGAG TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||