ID: 990440643

View in Genome Browser
Species Human (GRCh38)
Location 5:55841685-55841707
Sequence GTTTCACATTCCCATGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990440641_990440643 3 Left 990440641 5:55841659-55841681 CCTGATAGCTCCACTCAGCTGAC No data
Right 990440643 5:55841685-55841707 GTTTCACATTCCCATGTGAGAGG No data
990440642_990440643 -7 Left 990440642 5:55841669-55841691 CCACTCAGCTGACTTTGTTTCAC No data
Right 990440643 5:55841685-55841707 GTTTCACATTCCCATGTGAGAGG No data
990440639_990440643 10 Left 990440639 5:55841652-55841674 CCCATCACCTGATAGCTCCACTC No data
Right 990440643 5:55841685-55841707 GTTTCACATTCCCATGTGAGAGG No data
990440638_990440643 16 Left 990440638 5:55841646-55841668 CCAGAACCCATCACCTGATAGCT No data
Right 990440643 5:55841685-55841707 GTTTCACATTCCCATGTGAGAGG No data
990440640_990440643 9 Left 990440640 5:55841653-55841675 CCATCACCTGATAGCTCCACTCA No data
Right 990440643 5:55841685-55841707 GTTTCACATTCCCATGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990440643 Original CRISPR GTTTCACATTCCCATGTGAG AGG Intergenic
No off target data available for this crispr