ID: 990440812

View in Genome Browser
Species Human (GRCh38)
Location 5:55843073-55843095
Sequence TGCATGCATGTGCCCACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990440808_990440812 5 Left 990440808 5:55843045-55843067 CCCTTCTGTTCAGGTTAATCTTC No data
Right 990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG No data
990440806_990440812 9 Left 990440806 5:55843041-55843063 CCACCCCTTCTGTTCAGGTTAAT No data
Right 990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG No data
990440805_990440812 12 Left 990440805 5:55843038-55843060 CCACCACCCCTTCTGTTCAGGTT No data
Right 990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG No data
990440804_990440812 13 Left 990440804 5:55843037-55843059 CCCACCACCCCTTCTGTTCAGGT No data
Right 990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG No data
990440807_990440812 6 Left 990440807 5:55843044-55843066 CCCCTTCTGTTCAGGTTAATCTT No data
Right 990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG No data
990440802_990440812 14 Left 990440802 5:55843036-55843058 CCCCACCACCCCTTCTGTTCAGG No data
Right 990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG No data
990440809_990440812 4 Left 990440809 5:55843046-55843068 CCTTCTGTTCAGGTTAATCTTCC No data
Right 990440812 5:55843073-55843095 TGCATGCATGTGCCCACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990440812 Original CRISPR TGCATGCATGTGCCCACACA TGG Intergenic
No off target data available for this crispr