ID: 990442644

View in Genome Browser
Species Human (GRCh38)
Location 5:55861932-55861954
Sequence ATATGAGTATAGAGGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 361
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 336}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990442644 Original CRISPR ATATGAGTATAGAGGGAAGG AGG Intronic
900333172 1:2146849-2146871 ATATCTGTATAGAGGATAGGTGG - Intronic
904741529 1:32680249-32680271 ATATGAATATATGGGGAAAGAGG - Exonic
904794710 1:33050775-33050797 TTATGCCTTTAGAGGGAAGGGGG - Intronic
906862708 1:49378978-49379000 ATATGGGTATAGAGTGGTGGTGG - Intronic
907355840 1:53873253-53873275 ATGGGAGCATATAGGGAAGGTGG + Intronic
907789177 1:57645128-57645150 ATAGGAGGATAGAAGGGAGGTGG - Intronic
908338388 1:63150581-63150603 ATTTCAGTATGGAGGGATGGAGG + Intergenic
909169191 1:72272935-72272957 AAAGGAGAATAGAGGAAAGGAGG - Intronic
909368830 1:74860658-74860680 ATGTGATTATGTAGGGAAGGGGG + Intergenic
911829796 1:102536386-102536408 TCATGAGAACAGAGGGAAGGGGG + Intergenic
912164963 1:107032137-107032159 GAATGAGTATAGAGAGAAGAAGG - Intergenic
913662710 1:121018937-121018959 TGATGAGCATAGAGGGAAGAAGG - Intergenic
914652711 1:149710757-149710779 TGATGAGCATAGAGGGAAGAAGG - Intergenic
916667694 1:166981483-166981505 ATGTGTGTAGAGAGGGAGGGAGG + Intronic
919406877 1:197196222-197196244 ATATGAGAATAATGGGAAGGTGG + Intronic
920153158 1:203925705-203925727 AGATGAGTAGTGAGGAAAGGTGG - Intergenic
920845445 1:209589515-209589537 AGATGAGTATAGAAGGTGGGTGG - Intronic
921009941 1:211131944-211131966 CTATGATTACAGAGGGAAAGTGG + Intronic
921281166 1:213569439-213569461 CTAAGAGTATAGAAGGAAGCTGG - Intergenic
921370707 1:214419942-214419964 TTTTGAGGATAGAGGGATGGAGG - Intronic
921609135 1:217190365-217190387 ATATGATTAAAGTGGAAAGGAGG - Intergenic
922184712 1:223263906-223263928 ATCTGAGTATAGTGGGTAGGAGG - Intronic
922192294 1:223330045-223330067 ATAAGTGTATAGATGGAAGGAGG + Intronic
924155913 1:241176473-241176495 AAATGAGTGTAGAGGGAGTGGGG - Intronic
924534553 1:244923662-244923684 ATAAGATTATATAGGGAGGGTGG + Intergenic
924843278 1:247737246-247737268 ATATGTGTGTATAGAGAAGGAGG + Intergenic
1062881658 10:983539-983561 ATGTGAGCACAGAGAGAAGGCGG - Intergenic
1063658493 10:8015172-8015194 ATCTTACTATAGAGGGAAAGGGG - Exonic
1063788805 10:9415963-9415985 ATATGAGTGAAGATTGAAGGAGG - Intergenic
1064305641 10:14163842-14163864 ATATGAGTGTAGCAGGAAGAAGG - Intronic
1066731263 10:38439068-38439090 ATGAGAGTGTGGAGGGAAGGGGG + Intergenic
1069220801 10:65880624-65880646 ATAAGATGAAAGAGGGAAGGAGG - Intergenic
1070820047 10:79349132-79349154 AGATGGGTCTAGAGGGAAGGGGG + Intronic
1072029009 10:91498757-91498779 TTATGTGTTTAGAAGGAAGGGGG + Intronic
1072665469 10:97389482-97389504 ATGTGAGCACCGAGGGAAGGGGG + Intronic
1073825599 10:107316996-107317018 AGATGAGTGTAGAGGGAGGTAGG + Intergenic
1073938870 10:108670180-108670202 ATGTGAGCACACAGGGAAGGAGG + Intergenic
1074463904 10:113665454-113665476 ACATGAGTATAAGGGGAAGGCGG + Intergenic
1077771966 11:5228766-5228788 GTATGATTATAGAGGTAAGAGGG + Intronic
1078859522 11:15234304-15234326 ATATGTGTTTAGAAGGAAAGGGG + Intronic
1078941700 11:16013638-16013660 ATGGGAGTAAAGAGGGAGGGAGG - Intronic
1079068430 11:17319884-17319906 ATAGGAGGATAGAGGGCAGGAGG - Intronic
1080455252 11:32412862-32412884 AAATGAGTAAAGGGAGAAGGAGG + Intronic
1080821615 11:35812196-35812218 TTATGAGTATAAAGGAAATGGGG - Exonic
1081889846 11:46531737-46531759 GAATGAGGATAGAGTGAAGGAGG - Intronic
1084800346 11:71539460-71539482 ACATGAGGATATAGGGATGGCGG - Intronic
1085688970 11:78650432-78650454 ATATGAGAATAGAGGAAATGGGG - Intergenic
1086041700 11:82487036-82487058 AGAGGAGGAAAGAGGGAAGGGGG - Intergenic
1086514797 11:87599462-87599484 TTCTGAGTATACAGGGCAGGGGG - Intergenic
1086672757 11:89567589-89567611 GAATGAGTGCAGAGGGAAGGGGG + Intergenic
1087687847 11:101285572-101285594 AGATCAGTATAGAGAGAAGTTGG - Intergenic
1087901416 11:103645893-103645915 ATATGTTTAAAGAGGAAAGGTGG + Intergenic
1087947783 11:104185315-104185337 ATATGAATTTTGAGGGAGGGGGG - Intergenic
1088882135 11:113980644-113980666 ATATGAGGCTAGAGGGATAGCGG + Intronic
1089026723 11:115278587-115278609 CGATGAGTATAGAGGGAACAGGG + Intronic
1090268214 11:125368114-125368136 GATTGAGTAGAGAGGGAAGGAGG - Intronic
1090449299 11:126791901-126791923 AAAACAGTTTAGAGGGAAGGCGG + Intronic
1092673757 12:10892423-10892445 AGATGAGTCCAGAGGTAAGGGGG + Intronic
1093128661 12:15362058-15362080 ATATGAGAATGGAGAGAAGGAGG - Intronic
1093180595 12:15962771-15962793 AAATGAAGAAAGAGGGAAGGAGG - Intronic
1093217054 12:16375235-16375257 AGTTAACTATAGAGGGAAGGAGG + Intronic
1093377171 12:18444167-18444189 ATAACATTATAGAGGGAAGATGG - Intronic
1093481371 12:19607261-19607283 TCATGAGTATAGAAGCAAGGAGG + Intronic
1096382877 12:51173498-51173520 AAATGAATATACAGGGAAGTGGG - Intergenic
1096438752 12:51619921-51619943 GTATTAGTAGAGAGGGCAGGTGG + Intronic
1096929521 12:55191159-55191181 ATCTGAGGGTAGAGGGTAGGAGG - Intergenic
1098089251 12:66883434-66883456 ATATAAGTAGAGAGGGACTGGGG + Intergenic
1098426709 12:70372525-70372547 ATATGAGGAATGAGGGAAAGAGG + Intronic
1098480609 12:70954947-70954969 AGATGAGGAGAAAGGGAAGGTGG + Intergenic
1099488966 12:83264446-83264468 ATATGACTATAGAGGAAGGAAGG + Intergenic
1099840219 12:87955409-87955431 AGAGGAGTGAAGAGGGAAGGGGG - Intergenic
1100490062 12:95070778-95070800 AAATGAGAATAGGGGGAAGTCGG - Intronic
1100669784 12:96799099-96799121 ATTGGAGGATAGAAGGAAGGAGG + Intronic
1100891432 12:99130582-99130604 GGATGAGTAGAGAGGGAAGAAGG - Intronic
1106676795 13:31968387-31968409 ATCTGTGTATAGAGGGAAACTGG - Intergenic
1106688013 13:32082572-32082594 AACTGAGTTCAGAGGGAAGGAGG - Intronic
1107914043 13:45131220-45131242 AAAAGAGTATAGAGAGAAGAGGG + Intronic
1109437557 13:62325913-62325935 ATATGATGGTGGAGGGAAGGAGG - Intergenic
1110540386 13:76700900-76700922 ATATAAAGAGAGAGGGAAGGGGG + Intergenic
1111363003 13:87200966-87200988 ACCTGAGTGTAGAGGGTAGGAGG + Intergenic
1113528418 13:111000800-111000822 ATGTGAGGACAGTGGGAAGGTGG + Intergenic
1116964323 14:50998727-50998749 ATCACAGTACAGAGGGAAGGGGG + Intronic
1118476096 14:66118918-66118940 ATGTGAGGAAAGATGGAAGGAGG - Intergenic
1119219936 14:72898409-72898431 TTAGGAGTAAAGAGGGATGGGGG - Intergenic
1120320550 14:82955182-82955204 ATATGCGTGTGGAGGGTAGGAGG - Intergenic
1121288863 14:92758153-92758175 GTATGAGTACCCAGGGAAGGGGG - Intergenic
1121443660 14:93964938-93964960 ATAGGAGGATAGATGGAGGGTGG - Intronic
1121444740 14:93971372-93971394 ATGTGAGCAGAGAGGGCAGGGGG - Intronic
1122917567 14:104865905-104865927 AAATGAGGAGAGAGGGGAGGAGG - Intronic
1125073410 15:35583858-35583880 AACTGAATATAGAGGGAAAGGGG - Intergenic
1126369955 15:47934965-47934987 ATATGAGTGTTGAGAGAAGTTGG + Intergenic
1126801162 15:52297757-52297779 ATGTGTGAATAGAGGTAAGGAGG + Intergenic
1127358376 15:58223672-58223694 GTATGTGTATTGAGGGGAGGGGG - Intronic
1127889010 15:63230979-63231001 ATTTTAGTAGAGAGGGGAGGAGG - Intronic
1128612441 15:69084764-69084786 ATGTGATTAGAGAGGGAAAGAGG - Intergenic
1129144083 15:73632526-73632548 ATCTAGGGATAGAGGGAAGGTGG - Intronic
1129303366 15:74640020-74640042 ATATGAGCATAAGGGGCAGGTGG + Intronic
1130386583 15:83417320-83417342 ATATGAATTTGGGGGGAAGGTGG + Intergenic
1131707136 15:95009490-95009512 TTCTGAGTATAGAGGTAAGAAGG - Intergenic
1132138721 15:99370468-99370490 CTATGAGTATCTTGGGAAGGGGG + Intronic
1133597455 16:7306447-7306469 ATATGAAGATAGATGGAGGGTGG + Intronic
1133689548 16:8199993-8200015 ATGTGAGAAGAGAGGGAGGGAGG - Intergenic
1133829023 16:9304815-9304837 ACATGAGAATAGAGGAAAGATGG - Intergenic
1135239277 16:20789500-20789522 ATATGAGTAAACAGGAAAAGGGG - Intronic
1135602607 16:23796032-23796054 ATAGGAGAATAGAGGGTTGGGGG + Intergenic
1135911843 16:26568431-26568453 ATATATATATAGAGGGAAGTGGG + Intergenic
1137858123 16:51817345-51817367 ACTTGAGGATGGAGGGAAGGAGG - Intergenic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138754135 16:59461227-59461249 ATTTCAGTGTAAAGGGAAGGTGG + Intergenic
1138966000 16:62084669-62084691 AAAAGAGTTTAGAGGGAAAGGGG + Intergenic
1139022059 16:62761680-62761702 ATATTACCATAGATGGAAGGTGG + Intergenic
1139265449 16:65634332-65634354 ATAATAGTAACGAGGGAAGGAGG + Intergenic
1140478910 16:75252061-75252083 ATCTGAATCTAGAGGGAAAGGGG + Intronic
1140966269 16:79969106-79969128 AGAGAAGTATAGAGTGAAGGAGG + Intergenic
1142570373 17:869700-869722 AAATGAGTGAGGAGGGAAGGCGG + Intronic
1144622595 17:16827755-16827777 ATATGAATATATTGAGAAGGTGG + Intergenic
1144738481 17:17568158-17568180 ATATGAGTGTAGACAAAAGGTGG - Intronic
1144883833 17:18444955-18444977 ATATGAATATATTGAGAAGGTGG - Intergenic
1145042144 17:19584953-19584975 ATAGGAGTGTAGGGGGATGGGGG - Intergenic
1145148399 17:20499422-20499444 ATATGAATATATTGAGAAGGTGG + Intergenic
1146479935 17:33197103-33197125 AAATGGGTAGAGAGTGAAGGTGG + Intronic
1147576932 17:41607681-41607703 ATATGAATATATTGAGAAGGTGG + Intergenic
1149440170 17:56667225-56667247 ATATTTGTATAGATAGAAGGAGG + Intergenic
1149605897 17:57924915-57924937 AGATGAGTTTGGAGGGGAGGGGG + Intronic
1149753290 17:59166267-59166289 ATCTGAGTTTGAAGGGAAGGAGG + Intronic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1150297798 17:64023111-64023133 AAATGACTATGGTGGGAAGGAGG + Intergenic
1153328168 18:3843120-3843142 GTGTGTGTATATAGGGAAGGTGG + Intronic
1153728414 18:7981179-7981201 ATTTAAGTAGAGAGTGAAGGTGG - Intronic
1154999807 18:21675087-21675109 ATCTGGGGATAGATGGAAGGAGG - Intronic
1157017317 18:43732180-43732202 ATATGAGGAAAGAGGGAACTGGG - Intergenic
1157389071 18:47286031-47286053 ATATGAATATAGTGGAAAAGAGG + Intergenic
1158005980 18:52672624-52672646 AAAAGAGGAAAGAGGGAAGGAGG - Intronic
1159648413 18:70947682-70947704 ATTTGAGAGTAGAGGGTAGGAGG + Intergenic
1160026752 18:75224585-75224607 ATAAGAGTATTGCGGGGAGGGGG - Intronic
1162819407 19:13213393-13213415 ATAGGAGTATCCAGGGGAGGAGG - Intronic
1164725853 19:30465168-30465190 GAATGAGAATAGAGGCAAGGTGG - Intronic
1164826426 19:31287890-31287912 ATCTGAGTATTCAGGGAAGCAGG - Intronic
1164916736 19:32058133-32058155 ATAGGAGGAAAGAAGGAAGGAGG - Intergenic
1165929073 19:39344306-39344328 AAAAGAGTATATGGGGAAGGCGG - Intronic
1167807848 19:51801006-51801028 ATAAGAGTAAAAGGGGAAGGAGG - Intronic
1168015146 19:53566918-53566940 AGAGGAGGAGAGAGGGAAGGAGG - Intronic
1168532715 19:57142508-57142530 ATAGAAGTATGGAAGGAAGGAGG + Intronic
925620636 2:5789227-5789249 ACATGAGTGCAGAAGGAAGGAGG + Intergenic
926406797 2:12561846-12561868 ATAAGTGTAGAGAGGGAAGGTGG + Intergenic
926423935 2:12724426-12724448 ATATGAGTTTAGAGGGACAGAGG + Intronic
926633265 2:15156694-15156716 ATATGAGTTTTTAGGGGAGGGGG + Intergenic
929306119 2:40364024-40364046 ATATGAGTACAGAGGTAACATGG - Intronic
929524281 2:42685845-42685867 TTATAAGTATGGAGGGAAAGAGG - Intronic
929668897 2:43853898-43853920 ATGTGAGTACAGAGGGCAAGGGG - Intronic
930222084 2:48755429-48755451 AAAGGAGTAGGGAGGGAAGGTGG + Intronic
930311911 2:49752751-49752773 ATATGAGTTTAGATGAAAGTAGG + Intergenic
930428237 2:51239061-51239083 ATTAAAGTAGAGAGGGAAGGAGG - Intergenic
932281140 2:70492992-70493014 ATATGAGCCTATAGGGAATGAGG - Intronic
932574096 2:72953371-72953393 ATTTGAGACTGGAGGGAAGGAGG + Intronic
933583647 2:84155795-84155817 TTTTGAGTATAGAGTGAAGAAGG + Intergenic
933634984 2:84699023-84699045 AAAAGAGCACAGAGGGAAGGAGG + Intronic
935165944 2:100568671-100568693 ATAGGAGAAGAGAGGGGAGGAGG + Intronic
936490871 2:112971037-112971059 ATGTGAGAACAGAGAGAAGGCGG + Intergenic
936681038 2:114771612-114771634 ATAGGTGAATAGAAGGAAGGAGG + Intronic
938936094 2:136128818-136128840 ATAGGAGGATGGAAGGAAGGGGG - Intergenic
938995733 2:136675496-136675518 ATATGTGTGTAGTGGGGAGGGGG - Intergenic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
940012825 2:149072880-149072902 ATTTGAGTGAAGATGGAAGGAGG + Intronic
941400716 2:165026953-165026975 AAATGAGTGCAGAGCGAAGGGGG + Intergenic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
942673672 2:178404138-178404160 TTATCAGCTTAGAGGGAAGGGGG + Intergenic
943157997 2:184209335-184209357 GAATGAGAACAGAGGGAAGGAGG - Intergenic
943203643 2:184861470-184861492 AAATGAGTACAGAAGGAAAGAGG - Intronic
943590261 2:189787234-189787256 TTATGTATATAAAGGGAAGGAGG + Intronic
943599549 2:189898519-189898541 ATATGAGTAGAGAGGCATGTGGG - Intronic
943601122 2:189922436-189922458 ACATGGGTATAGAGAGAAGTAGG + Intronic
944011318 2:194978658-194978680 AAATGAGTGTCGAGTGAAGGGGG + Intergenic
944696950 2:202210230-202210252 ATATCTCTATAGAGGGAAGATGG + Intronic
944732321 2:202529336-202529358 ATTTGGGTATGGAGGGAGGGTGG - Intronic
944977828 2:205077156-205077178 AGGTGAGTAGAGAGGGAGGGAGG + Intronic
947558052 2:231115699-231115721 GTCTGAATATAGAGGTAAGGAGG + Intronic
1168922993 20:1556681-1556703 ATGTGAGGATACAGGGAGGGTGG + Intronic
1169945766 20:10986241-10986263 AGATGAGTAGAAAGTGAAGGAGG + Intergenic
1172518471 20:35552254-35552276 GAATGAGGAGAGAGGGAAGGAGG + Intronic
1173300644 20:41799364-41799386 AGCTGAGTATGGAGGGAAGCTGG + Intergenic
1173402362 20:42736806-42736828 AGATGAGGAGAGATGGAAGGAGG + Intronic
1175362486 20:58424298-58424320 AGATGAGAATAAAGGGAAAGGGG + Intronic
1175448186 20:59041049-59041071 GAAAGAGTGTAGAGGGAAGGAGG + Intronic
1176931726 21:14820213-14820235 ATTTGAGTAAATAGGGAAAGCGG + Intergenic
1177033964 21:16018680-16018702 ATTTGAGGGTAGAGGGTAGGGGG + Intergenic
1177183184 21:17765667-17765689 GCATGAGTAGAGAGAGAAGGAGG + Intergenic
1177206917 21:18020929-18020951 ATATAAATATAGAGAGAAGGGGG - Intronic
1177433127 21:21016069-21016091 CAATGAGTATTGAGGGAAGTTGG - Intronic
1178086615 21:29118727-29118749 AGATGAGTATGGAGGAAAGGAGG + Intronic
1178256382 21:31056266-31056288 ATAAGAATATAGGGAGAAGGTGG - Intergenic
1178454358 21:32733556-32733578 AAATGAGTGCTGAGGGAAGGGGG - Intergenic
1178478708 21:32960062-32960084 ATCAGAAAATAGAGGGAAGGTGG - Intergenic
1179040518 21:37798336-37798358 ACATGAGGCTAGTGGGAAGGAGG - Intronic
1179805271 21:43833203-43833225 GTATGAGTCAAGTGGGAAGGTGG - Intergenic
1181901529 22:26160192-26160214 AGAAGAGGAGAGAGGGAAGGAGG + Intergenic
1182353629 22:29712415-29712437 ATGAGAGTAGAGAGGGGAGGAGG + Intergenic
1183002839 22:34875921-34875943 TGATGAGGATGGAGGGAAGGGGG + Intergenic
1183459612 22:37941918-37941940 AGAGGTGTGTAGAGGGAAGGGGG - Exonic
1184190200 22:42889438-42889460 ATTTCATTCTAGAGGGAAGGAGG + Intronic
1184884798 22:47336330-47336352 AGATGAGGATAGAGGGATGGAGG - Intergenic
949797992 3:7871941-7871963 ATATGAGAACAGAGGGGTGGTGG - Intergenic
950203853 3:11062951-11062973 AGATGAGTGTGGAGGGAGGGAGG + Intergenic
952796956 3:37247905-37247927 ATATGGGTCTAGAGGGCAGAGGG - Intronic
955603543 3:60673997-60674019 AAATGAGGATAGAGAGAATGAGG - Intronic
957331735 3:78773740-78773762 ATATGAGACTAGAGGGAGGAAGG - Intronic
957845424 3:85727720-85727742 ATATGAGTGTAAAGGGAACCAGG + Intronic
958834524 3:99129079-99129101 ATAAGAGGAAAGTGGGAAGGGGG + Intergenic
959494685 3:107036494-107036516 ACCTGAGTTTAGAGGTAAGGAGG + Intergenic
959556579 3:107726308-107726330 ATATGAGCATCAAGGGAGGGTGG - Intronic
961701523 3:128748428-128748450 CTTTGAGTAGACAGGGAAGGTGG + Intronic
961903861 3:130242181-130242203 AGGTGAGTAAAGAGGGAAGAAGG - Intergenic
962263300 3:133928381-133928403 AGATGAGAAGAGAGAGAAGGTGG + Exonic
962846332 3:139277333-139277355 AGATGTTTATAGAGGGAATGGGG + Intronic
963504824 3:146171106-146171128 AAAAGATTATAGAGGGAGGGAGG - Intergenic
963720356 3:148854937-148854959 ATATTAGTAAAGAGAGAAAGAGG + Intronic
964458666 3:156897043-156897065 ACTTGAGGATAGAGGGTAGGAGG + Intronic
964756963 3:160097227-160097249 GTATGAGTCTAGGGGGAAGTGGG - Intergenic
965508238 3:169539836-169539858 ATTTGACTGTAGAGGGTAGGGGG - Intronic
965969153 3:174532413-174532435 ATTTGAGTAGAGAAGGAAAGGGG + Intronic
966479889 3:180395418-180395440 ATATGAGCATAGAGAAAAGTAGG + Intergenic
967413283 3:189188672-189188694 ATATGAGGGAAGAGGGAGGGAGG - Intronic
969537200 4:7763705-7763727 AGATGAGGATACAGGCAAGGGGG + Exonic
970269930 4:14335159-14335181 ACAAGAGGAAAGAGGGAAGGAGG + Intergenic
970410592 4:15803798-15803820 ATAAGAGGAGGGAGGGAAGGAGG - Intronic
970992384 4:22227803-22227825 ATATGAGGGTAGAGGGTCGGGGG + Intergenic
971942757 4:33237004-33237026 ATATGAGAAGAGAAGGAAAGAGG + Intergenic
972009308 4:34156230-34156252 AAATGAGTGTCGAGTGAAGGGGG + Intergenic
972913790 4:43850716-43850738 ATATGAGGAAAGAAGGAAGGAGG - Intergenic
973801920 4:54486942-54486964 ATATGAATTTGGAGGGAAGTGGG - Intergenic
973976852 4:56271443-56271465 ATATGGGGATAGAGGGAATTAGG + Intronic
974245628 4:59312938-59312960 TGATGAGTATAGAGAGAAGTAGG + Intergenic
974396846 4:61347550-61347572 ATATGAGGCCAGAGGGAAGGGGG - Intronic
974424886 4:61729046-61729068 ATATTTGTAGAGAGGGAGGGAGG + Intronic
974456414 4:62134168-62134190 ACATGTGACTAGAGGGAAGGAGG + Intergenic
974598590 4:64045975-64045997 ACTTGAGTGTAGAGGGTAGGAGG + Intergenic
974787301 4:66635775-66635797 ACATGAGTATTGAGTTAAGGTGG + Intergenic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976770411 4:88646213-88646235 ATATGAGTCTAGGGGGTAGATGG - Intronic
976979768 4:91212885-91212907 ATAAGAGTAGGGAGAGAAGGAGG - Intronic
977008010 4:91596525-91596547 ATATAAGTTTACAGGGATGGAGG + Intronic
978264197 4:106803091-106803113 ACATGAGGAAAGAGGGAAGAGGG - Intergenic
979783050 4:124680499-124680521 ACAGGAGGGTAGAGGGAAGGTGG + Intronic
980006218 4:127545010-127545032 ATATAAGAATAGAGAAAAGGTGG + Intergenic
980478002 4:133345059-133345081 ATTTGTATGTAGAGGGAAGGAGG + Intergenic
980579217 4:134728056-134728078 AAATGAGGAAAGTGGGAAGGAGG + Intergenic
980754158 4:137135870-137135892 GAATGAGTGTGGAGGGAAGGGGG - Intergenic
981132415 4:141172468-141172490 AAATGTGTGTATAGGGAAGGGGG - Intronic
982756734 4:159228854-159228876 ATATAAGTATAAAAGGAAAGTGG - Intronic
983380754 4:166989952-166989974 TTATAAGTAGAAAGGGAAGGGGG + Intronic
984305242 4:177980998-177981020 ATATGAGGATGGAGGGTGGGAGG - Intronic
984786296 4:183570484-183570506 ATATGAGGGTAGAAGGGAGGGGG - Intergenic
985036763 4:185848131-185848153 ATATGAGTACAGTGGAATGGAGG + Intronic
985037089 4:185851393-185851415 ATATGATTATAAAGGAAAGGTGG + Intronic
1202753544 4_GL000008v2_random:33282-33304 TCATGAGTTTAAAGGGAAGGAGG - Intergenic
985849599 5:2378963-2378985 ATCTGAATACAGAGGGGAGGGGG + Intergenic
986906547 5:12501233-12501255 ACATCAGTGTAGAGGGAAGGGGG - Intergenic
987124249 5:14796558-14796580 ATATGAATATATGGGGAAAGAGG + Intronic
988974974 5:36506270-36506292 AGAAGAGAATGGAGGGAAGGGGG + Intergenic
989224710 5:39012268-39012290 AAATGAGTGTTGAGTGAAGGGGG - Intronic
990442644 5:55861932-55861954 ATATGAGTATAGAGGGAAGGAGG + Intronic
990581719 5:57172909-57172931 ACATTTGTTTAGAGGGAAGGTGG - Intergenic
991012529 5:61898966-61898988 AAATGAAGGTAGAGGGAAGGGGG + Intergenic
991324201 5:65411690-65411712 ATAAGTGTATAAAGGGAAGGAGG + Intronic
993126756 5:83844725-83844747 GTATGACTTCAGAGGGAAGGTGG + Intergenic
994611065 5:102040347-102040369 TTGTGTGTATAGAGGGGAGGGGG - Intergenic
994708218 5:103231949-103231971 ATAAGGGTACAGTGGGAAGGTGG + Intergenic
995672246 5:114619174-114619196 ATATGAGGATGGAGGGTGGGAGG + Intergenic
996110658 5:119562677-119562699 ATCTGAGTCAAGAGGGCAGGCGG + Intronic
997402662 5:133614021-133614043 AAATGAGTATAAAAGGAAGCAGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998706729 5:144770524-144770546 ATTGGAGTAGAAAGGGAAGGAGG - Intergenic
999052761 5:148541581-148541603 ATCTGAGTATTGAAGAAAGGTGG + Intronic
1001078422 5:168647673-168647695 GAATGAGAATAGAGCGAAGGAGG + Intergenic
1001326037 5:170725476-170725498 ATATGAAGATAGAGGGCAGAAGG + Intronic
1002489568 5:179565084-179565106 ATATTAGTGTATAGGGGAGGGGG + Intronic
1003173379 6:3737470-3737492 AGTTGACTATAGAGGGAGGGAGG - Intronic
1003761168 6:9180483-9180505 ATATGGATATACTGGGAAGGGGG + Intergenic
1004700557 6:18075462-18075484 AAATGAGTACCAAGGGAAGGGGG + Intergenic
1005863402 6:29918583-29918605 ATGGAAGTAAAGAGGGAAGGAGG - Intergenic
1006871571 6:37256820-37256842 ATTTGGGGAAAGAGGGAAGGCGG - Intronic
1008043652 6:46829633-46829655 GTAGGAGGAAAGAGGGAAGGAGG - Intronic
1008659638 6:53652629-53652651 ATTTGAATATGGAGGAAAGGGGG - Intronic
1008761746 6:54860351-54860373 ATAGGAGTATAGAGGAAGTGAGG - Intronic
1009469681 6:64017100-64017122 ATATGAGTGCAAAGGCAAGGAGG + Intronic
1009863994 6:69373767-69373789 ATGTTAGTATAAAGGAAAGGAGG + Intronic
1010507221 6:76675405-76675427 ATTTGAGGGTAGAGGGAGGGAGG - Intergenic
1013703042 6:112796854-112796876 GTATGATTGCAGAGGGAAGGAGG - Intergenic
1013962207 6:115914020-115914042 ATATGAATAGAGAGGGAAAGTGG - Intergenic
1015821271 6:137263345-137263367 TTATAAATATAGAGGGTAGGAGG + Intergenic
1017195784 6:151698569-151698591 ATTTGTGGGTAGAGGGAAGGAGG + Intronic
1017668459 6:156745357-156745379 ATGTGAGTAAAGAGGGAATTTGG + Intergenic
1018086095 6:160302449-160302471 ACTTGAGTTTAGAGGGATGGAGG + Intergenic
1018265264 6:162017390-162017412 ATATGTGTATAGAAGGCATGTGG + Intronic
1020628241 7:10609256-10609278 ATCTAAGTAGAGAGGGAAAGAGG - Intergenic
1021476910 7:21072329-21072351 AAATGAGTGTAGAGGAAAGAGGG + Intergenic
1022009632 7:26297625-26297647 ATGTGAGGAAAGAAGGAAGGAGG - Intronic
1022324312 7:29317167-29317189 ATAGAAGTAGATAGGGAAGGAGG + Intronic
1023457144 7:40352457-40352479 ACTTGAGAGTAGAGGGAAGGAGG - Intronic
1023567519 7:41538359-41538381 ACATGAGGCTAGAGGGAAGCAGG + Intergenic
1024342447 7:48281218-48281240 ATATGATTATGCAGGGAGGGAGG + Intronic
1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG + Intergenic
1024791316 7:52967832-52967854 ATGTGGGGATACAGGGAAGGGGG - Intergenic
1027461146 7:78455152-78455174 ATATGTGTGTGGAGGGAGGGTGG + Intronic
1027814512 7:82951988-82952010 ATATGGTTATAGAGGGATTGGGG - Exonic
1027893532 7:84009751-84009773 GGATGAGGAAAGAGGGAAGGAGG + Intronic
1028143970 7:87301125-87301147 ACTTGAGTGTAGAGGGAAGGAGG + Intergenic
1028422314 7:90647651-90647673 ATTTGAATAGATAGGGAAGGTGG + Intronic
1029675363 7:102064831-102064853 TTCTGAGTCTAGAGGGAGGGAGG - Intronic
1030318343 7:108139175-108139197 ATGTGAGGACAGAGAGAAGGTGG - Intergenic
1031647742 7:124247464-124247486 ACTTGAGGGTAGAGGGAAGGAGG - Intergenic
1032467392 7:132154703-132154725 AGAAGAGTTTAGAGGGCAGGTGG + Intronic
1033233499 7:139620114-139620136 ATGTGGGAATAGGGGGAAGGGGG - Intronic
1034050422 7:147978198-147978220 ATATGAATATAGAGGAAAGATGG - Intronic
1036728090 8:11238179-11238201 AGATGAGTATGGTGGTAAGGAGG + Intergenic
1038830033 8:31047066-31047088 ATTTAAGTATAGGGGGAAGAGGG - Intronic
1039648398 8:39312808-39312830 ATAGGAGTATAGGGGAAAGCTGG - Intergenic
1042236444 8:66617563-66617585 AGATAAGGAAAGAGGGAAGGAGG + Intergenic
1045909239 8:107386237-107386259 ATTTGAGGATGGAGGGTAGGAGG + Intronic
1046200524 8:110921846-110921868 ATCTGAGTCTATAGGGAAGAAGG + Intergenic
1046276492 8:111967381-111967403 ATTTGAATATAGAGGGAAGTTGG - Intergenic
1046411912 8:113855981-113856003 AAAGGAGAATAGAGGGAATGGGG - Intergenic
1047040995 8:120995552-120995574 ATGTGAGGATAGGGAGAAGGTGG - Intergenic
1047395653 8:124496496-124496518 ATAAGGGGTTAGAGGGAAGGAGG - Intronic
1049042063 8:140119911-140119933 AGATGTGTATAGAAGGAAGTAGG - Intronic
1050175787 9:2868215-2868237 ACATGAGGATAGAGGGTGGGAGG - Intergenic
1050823005 9:9906342-9906364 AATTGAGTATAGAGTGAAGTTGG - Intronic
1052230824 9:26150470-26150492 ATAAGAGTAAAGATGTAAGGAGG - Intergenic
1053187365 9:36028396-36028418 ATAAGAGTATAAAGGAAAGCAGG + Intergenic
1053205818 9:36185779-36185801 ATGTGAGGACAGAGTGAAGGTGG + Intergenic
1054778742 9:69147054-69147076 ATATGCGTGGAGAGGGCAGGGGG + Intronic
1054883163 9:70166359-70166381 ATATAAATATAGAAAGAAGGGGG + Intronic
1055634122 9:78257612-78257634 AGAGGAGAAAAGAGGGAAGGAGG + Intronic
1057873744 9:98737116-98737138 ATGTGTGTATAGGGGGCAGGGGG - Intronic
1059210193 9:112507090-112507112 ATTTGTGGGTAGAGGGAAGGAGG + Intronic
1059909664 9:119028179-119028201 ATAAGAATATAGAGGCAAGCTGG - Intergenic
1061638067 9:131928030-131928052 ATATGAGTGTAGAGGGCTTGGGG - Intronic
1186045559 X:5532852-5532874 ATAGAAGGAGAGAGGGAAGGAGG + Intergenic
1186706100 X:12140176-12140198 ATGTTAGTAGAAAGGGAAGGTGG - Intronic
1188601215 X:31967420-31967442 ACATGAATAAAGAGGGAAAGAGG + Intronic
1189166859 X:38868939-38868961 ATCTTAGTATGGAGGGAGGGTGG + Intergenic
1189756643 X:44278632-44278654 ATGCGAGTCTATAGGGAAGGAGG - Intronic
1191109634 X:56794531-56794553 AGAAGAATCTAGAGGGAAGGGGG - Intergenic
1192047352 X:67689958-67689980 ATAGGAGGAAAGTGGGAAGGAGG - Intronic
1192145332 X:68678358-68678380 AGAGGAGTAAAAAGGGAAGGAGG + Intronic
1193928259 X:87518013-87518035 ATATGAGCATAGAGGGACCCCGG + Exonic
1195610160 X:106857560-106857582 ACATGAGTATGGAGGGTGGGAGG - Intronic
1196175542 X:112635652-112635674 ATAGGAATATCCAGGGAAGGAGG + Intronic
1196468668 X:115999371-115999393 GAATGAGTAGAGATGGAAGGGGG - Intergenic
1198061283 X:133047607-133047629 ATCTGAATATGGGGGGAAGGTGG - Intronic
1198495058 X:137183954-137183976 ATGTGTGTATAGAGGGGTGGTGG - Intergenic
1198661702 X:138975887-138975909 ATGTGAATATACTGGGAAGGTGG + Intronic
1198708811 X:139478887-139478909 ATATAACTAAAGAGGGAAGTAGG + Intergenic
1198778523 X:140207907-140207929 ATATGTGTATGGTGGGCAGGAGG + Intergenic
1200164301 X:154025530-154025552 AGATGAGAAGAGTGGGAAGGAGG + Intronic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201906324 Y:19089262-19089284 ATATGGTTTCAGAGGGAAGGTGG - Intergenic
1202163646 Y:21963253-21963275 AGATGAGGGGAGAGGGAAGGAGG - Intergenic
1202227710 Y:22623112-22623134 AGATGAGGGGAGAGGGAAGGAGG + Intergenic
1202315447 Y:23573066-23573088 AGATGAGGGGAGAGGGAAGGAGG - Intergenic
1202555354 Y:26097531-26097553 AGATGAGGGGAGAGGGAAGGAGG + Intergenic