ID: 990446749

View in Genome Browser
Species Human (GRCh38)
Location 5:55900187-55900209
Sequence GAGCAGTCCCTGTGCTCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 203}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990446747_990446749 -7 Left 990446747 5:55900171-55900193 CCATCAATTGGCCAAGGAGCAGT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG 0: 1
1: 0
2: 2
3: 14
4: 203
990446744_990446749 0 Left 990446744 5:55900164-55900186 CCTGGTCCCATCAATTGGCCAAG 0: 1
1: 0
2: 16
3: 99
4: 331
Right 990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG 0: 1
1: 0
2: 2
3: 14
4: 203
990446746_990446749 -6 Left 990446746 5:55900170-55900192 CCCATCAATTGGCCAAGGAGCAG 0: 1
1: 0
2: 0
3: 7
4: 80
Right 990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG 0: 1
1: 0
2: 2
3: 14
4: 203
990446742_990446749 9 Left 990446742 5:55900155-55900177 CCTTAGGTGCCTGGTCCCATCAA 0: 1
1: 0
2: 1
3: 6
4: 83
Right 990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG 0: 1
1: 0
2: 2
3: 14
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990446749 Original CRISPR GAGCAGTCCCTGTGCTCTCA AGG Intronic
900587361 1:3439738-3439760 GAGCAGACCCAGTCCCCTCAGGG + Intergenic
900849284 1:5129720-5129742 GAGAATTCCATTTGCTCTCATGG - Intergenic
901185127 1:7368030-7368052 GTGCAGGCCCTGGGCACTCATGG + Intronic
901232537 1:7649289-7649311 GAGCCGGGCCTCTGCTCTCAGGG - Intronic
902458662 1:16554536-16554558 GAGCAGTCACTGAACTGTCAGGG - Intergenic
902493495 1:16853380-16853402 GAGCAGTCACTGAACTGTCAGGG + Intronic
903151849 1:21415296-21415318 GAGCAGTCACTGAACTGTCAGGG - Intergenic
903651654 1:24926213-24926235 GACCAGTGACTGTCCTCTCAGGG + Intronic
905010746 1:34745494-34745516 GAGCAGTCCCTGGGCTGGCTGGG + Intronic
905291697 1:36926098-36926120 GAGGAATCACTGTGATCTCAGGG - Intronic
908868161 1:68576063-68576085 GGGGAGACCCTCTGCTCTCAAGG + Intergenic
910747596 1:90590739-90590761 GAGGATTCCCTGTGCCCTCATGG + Intergenic
913123447 1:115763336-115763358 TGGCATTCCCTCTGCTCTCAAGG - Intronic
913606987 1:120475830-120475852 GAGCAGTCACTGAACTGTCAGGG + Intergenic
914209446 1:145564314-145564336 GAGCAGTCACTGAACTGTCAGGG - Intergenic
914268366 1:146056682-146056704 GAGCAGTCACTGAACTGTCAGGG - Intergenic
914368729 1:147004179-147004201 GAGCAGTCACTGAACTGTCAGGG + Intergenic
914584205 1:149046008-149046030 GAGCAGTCACTGAACTGTCAGGG - Intronic
915328635 1:155094427-155094449 GAGCAGTCCCTGAGCCTTCTAGG + Intergenic
916582808 1:166123704-166123726 GGGCAGTTCCTGGGATCTCAGGG + Intronic
917913477 1:179676523-179676545 TAGCAGTTCCTGTGCTGTCTTGG + Intronic
919249252 1:195030981-195031003 TAGGCATCCCTGTGCTCTCAGGG - Intergenic
922181227 1:223234367-223234389 GATCACTGCCTGTGCACTCAGGG - Intronic
922597070 1:226822274-226822296 GAGCAGTCACTGAGATCTCAGGG - Intergenic
1063123749 10:3122911-3122933 GAGCCCACCCTGTGCTCTGAGGG - Intronic
1064101536 10:12468615-12468637 GAGCACTGCCTGTGTTCTCTGGG + Intronic
1064504433 10:16013618-16013640 GTGCAGTCCATGTGATCCCAAGG - Intergenic
1066048478 10:31614947-31614969 GACCTGGCCCTGTGCCCTCACGG + Intergenic
1066301665 10:34102575-34102597 GAGAAGCGCCCGTGCTCTCAGGG + Intergenic
1068026984 10:51658379-51658401 GGGCAGTCACAGTGCTCTGAGGG + Intronic
1069559206 10:69417782-69417804 CAGCAGCCTCTGTGCTCCCAGGG + Intergenic
1069686823 10:70324077-70324099 GGGCAGTCACTGTGGTCTCGGGG - Intronic
1069986455 10:72287459-72287481 CAGCAATACCTCTGCTCTCATGG - Intergenic
1073844973 10:107544722-107544744 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
1075467221 10:122660832-122660854 GAGCAGCCCCTCAGCTCTCTAGG - Intergenic
1076416044 10:130289751-130289773 GAGTTGACCCTGTGCTCTAAAGG + Intergenic
1077112123 11:866480-866502 GAGCAGTCCCTGTCCTCAGCAGG - Intronic
1077369185 11:2173642-2173664 GTGCAGACCCTGTCCTCTCTCGG + Intergenic
1079466971 11:20740334-20740356 GAGCAGTCCCTGCCATCTCTGGG + Intronic
1081447255 11:43142591-43142613 GAGGATTCCCAGTGCTCACAGGG + Intergenic
1081702627 11:45161630-45161652 GAGCCGTCCCGGGACTCTCAGGG - Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1083394366 11:62379662-62379684 AAGCAGTCTCTCTGCTTTCAGGG - Intronic
1083729636 11:64645812-64645834 GAGCAGGGCCTGTCCTCTGAAGG - Intronic
1088140070 11:106605236-106605258 AAATAGTCCCTGTGCCCTCAAGG + Intergenic
1089721955 11:120433500-120433522 AGACAGTCCCTCTGCTCTCAAGG - Intronic
1090227745 11:125081795-125081817 GAACAGTCCCTGCTCTATCAGGG + Exonic
1090362826 11:126185394-126185416 GAGCAGCCGCTGTGCTCCGACGG - Intergenic
1091611971 12:2018273-2018295 TACCATTCCCTTTGCTCTCAAGG - Intronic
1093052736 12:14521317-14521339 GAGCAGTCCCTATGCACTTGCGG + Intronic
1093842465 12:23921140-23921162 GAATAGTCCCTGTGCTGCCAAGG + Intronic
1096312409 12:50532795-50532817 GCGCTGTCCTTGGGCTCTCAGGG + Intronic
1097701854 12:62828368-62828390 GAGCCGGCCCTATGTTCTCAGGG - Intronic
1098178812 12:67823105-67823127 GAGCAATCCATGTACTCTCCTGG - Intergenic
1102907838 12:116690625-116690647 GAGAAGACCCTGTGCTGTCATGG - Intergenic
1104667701 12:130659018-130659040 GGGGAGTCCCTGTGCTGGCATGG - Intronic
1107228951 13:38085905-38085927 CAGGCATCCCTGTGCTCTCATGG + Intergenic
1109348376 13:61145118-61145140 CAGCCATCCTTGTGCTCTCAGGG + Intergenic
1118707782 14:68495829-68495851 GGGCTGCCCCTGTGTTCTCAAGG + Intronic
1120741134 14:88110204-88110226 CAGCAGTGGCTATGCTCTCAGGG - Intergenic
1121493204 14:94374768-94374790 GGGCAGGCTGTGTGCTCTCAGGG - Intergenic
1122874935 14:104659623-104659645 AATCAGGCCCTGTGATCTCAGGG - Intergenic
1128876003 15:71201869-71201891 CAGCAGTGCCTGTGCTACCAAGG - Intronic
1130228482 15:82078375-82078397 GAGGAGTTCCTTTGCTCTCTTGG - Intergenic
1131873752 15:96783934-96783956 GAGCAGCCCCTGTGCACTTGGGG + Intronic
1133153594 16:3855698-3855720 GTACAGGCCCTGTGCCCTCATGG - Intronic
1133374000 16:5268646-5268668 GACCAGTCAATGTGCCCTCATGG + Intergenic
1134421300 16:14092217-14092239 AAATAGTCCCTGTCCTCTCAGGG - Intronic
1134782352 16:16909648-16909670 GAGCAGTCCCTGTGGCTTCTCGG + Intergenic
1136027246 16:27476570-27476592 GAGCAGTGCCTGTGGTCTCATGG - Intronic
1138609987 16:58115260-58115282 GAGCAGTACCTGCACTCTGAGGG + Exonic
1138998149 16:62477781-62477803 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
1141553068 16:84819134-84819156 GGGCAGTCCCTTAGCTCTTAAGG + Intergenic
1143520542 17:7441848-7441870 GAGCAGTCCCTCAGCATTCATGG - Exonic
1143857887 17:9865872-9865894 GAGCATTCCCTTTGGTCACAAGG + Intronic
1144703142 17:17351478-17351500 GCGCAGTCCCTGGGCCCTCTGGG - Intergenic
1146604271 17:34244960-34244982 TGGCTGTCCCTCTGCTCTCATGG + Intergenic
1146667428 17:34714539-34714561 GGGCAGTGTCTCTGCTCTCAGGG - Intergenic
1149257356 17:54841704-54841726 GAGAAGTGCATGGGCTCTCAGGG + Intergenic
1149661472 17:58336349-58336371 TAGCACTCCTTGTGCTCCCAAGG - Intergenic
1150930663 17:69581393-69581415 GTCCAGTCCCTGGGCTCTCCCGG + Intergenic
1151510835 17:74558797-74558819 GAGCAGTTCCTGTCCTGTTAAGG - Intergenic
1152467222 17:80473174-80473196 GAGCAGCCCCCGGGCTCACAGGG - Intronic
1152899367 17:82931226-82931248 GAGCGGCATCTGTGCTCTCATGG - Intronic
1155395901 18:25386637-25386659 GTGCAGTCTCCCTGCTCTCATGG - Intergenic
1158390082 18:57037877-57037899 GAACAGCCCCTGTCCTGTCAGGG - Intergenic
1158435529 18:57433289-57433311 TTTCAGTCCCTGTGCACTCATGG + Intergenic
1161010085 19:1955697-1955719 GAGCACTCCCTGCACCCTCAGGG - Intronic
1162301274 19:9846534-9846556 GAGCTATGGCTGTGCTCTCACGG + Intronic
1163119818 19:15210660-15210682 CAGCAGGCCTTGTGCTCCCATGG + Intergenic
1164121915 19:22273271-22273293 GAGCAGTTCCTGTCCTTTTAAGG + Intergenic
1164558133 19:29269160-29269182 CAGCAGTCTCTCTGCTCTCCAGG + Intergenic
1166460631 19:42984938-42984960 GAGCATGCCCTGTACTCTCCAGG - Intronic
1167588051 19:50386067-50386089 GAGAAGAACCTGTGCGCTCAGGG + Intronic
1167972247 19:53195494-53195516 CTGCAGTCCCTGTGTTTTCATGG - Intergenic
1168292311 19:55362596-55362618 GAGCAGTCCCTGTCCTCGGCGGG + Exonic
1202708877 1_KI270714v1_random:5574-5596 GAGCAGTCACTGAACTGTCAGGG + Intergenic
929030207 2:37643281-37643303 CAGCAGTCCACCTGCTCTCAGGG + Exonic
929602144 2:43211041-43211063 GAGCAGTCCCAGTGGGCTCAGGG - Intergenic
930179953 2:48345104-48345126 GAACTGTCCCTGTACTTTCAAGG - Intronic
932340097 2:70958245-70958267 GGGCACTTTCTGTGCTCTCAGGG - Intronic
933011488 2:77069699-77069721 TAGAAGGCCCTGTGCTCTCGTGG - Intronic
935640419 2:105284775-105284797 GAGTCGGCCCTGTGCTCTGAGGG - Intronic
936662436 2:114557280-114557302 GAGCAAGCCATTTGCTCTCAGGG + Intronic
937849180 2:126617671-126617693 GAGCAGCCTCTGTGCTCACATGG - Intergenic
938379707 2:130829615-130829637 GAGCAGGCACTCTGCCCTCATGG - Intergenic
941151317 2:161918953-161918975 CAGGCATCCCTGTGCTCTCAGGG + Intronic
941394315 2:164955574-164955596 TAGCTCTCCCTGTTCTCTCAGGG - Intergenic
941812657 2:169768998-169769020 GAGGCGTGCCTGGGCTCTCAGGG + Intronic
943666876 2:190618324-190618346 TAGCAGTTCCTGGACTCTCAAGG + Intergenic
944539287 2:200741163-200741185 GAGCAGTCCCTTGGCCCACAGGG - Intergenic
945212428 2:207397594-207397616 GGGCAGTCCAGGTTCTCTCAAGG - Intergenic
945617444 2:212090109-212090131 GAGCAGACCATGTGTTCTAATGG - Intronic
948104973 2:235406227-235406249 AAGCAGTCCCTCAGGTCTCACGG - Intergenic
949043772 2:241860967-241860989 CTGCAGGCCCTGTGCTCTCCAGG - Intergenic
1172513153 20:35514506-35514528 GTGCTGCCCCTGTTCTCTCAAGG + Exonic
1172895342 20:38296080-38296102 GATGAGTCCCAGAGCTCTCAGGG - Intronic
1175800753 20:61799939-61799961 GAGATGGCCCTGGGCTCTCAGGG - Intronic
1178131899 21:29582836-29582858 GAGCATTCTCTGTGTTCTCATGG - Intronic
1179646086 21:42777224-42777246 GAGCAGTCCCTGAGGCCCCACGG + Intergenic
1181181892 22:21074240-21074262 TAGGTGTCCCCGTGCTCTCAGGG + Intergenic
1181494985 22:23282672-23282694 GATGAGGCCTTGTGCTCTCAGGG - Intronic
1183472990 22:38019418-38019440 GAGCAGTCCGTGGCCTCACAAGG + Intronic
1184054511 22:42035380-42035402 CAGGCATCCCTGTGCTCTCAGGG - Intronic
1184869546 22:47226456-47226478 CAGGCATCCCTGTGCTCTCAGGG - Intergenic
1184897026 22:47415480-47415502 TAGCATTCCCTGTGCTCTCATGG + Intergenic
1185221236 22:49630174-49630196 GACCAGTCCCTGTCCCTTCAGGG + Intronic
950038354 3:9903146-9903168 CCGCAGTCCCTGTGCTCTGGTGG + Intronic
950038922 3:9907079-9907101 GAGCAGTCCCTATGATGTCCAGG + Exonic
950330037 3:12149025-12149047 CAGCAGTCCCTGTCTGCTCAAGG - Intronic
950442194 3:13016532-13016554 GAGCAGTCCCCGTGGTGGCAGGG - Intronic
951718565 3:25674292-25674314 GAGGCATCCCTGTACTCTCAGGG - Intergenic
952455238 3:33466379-33466401 GAGAAGCCCCTGTACTCGCAGGG + Intergenic
952944979 3:38473142-38473164 GGGCAGTCCCTATGCTCCAAGGG - Intronic
954363233 3:50133371-50133393 GATCAGACCCTGGGATCTCAGGG + Intergenic
955370044 3:58343349-58343371 AGCCATTCCCTGTGCTCTCACGG - Intronic
957665430 3:83218940-83218962 AGGGAGTCCCTGTGCTCTCAGGG - Intergenic
960994823 3:123333715-123333737 GAGCAGGCCCAGTGCCCTCGAGG - Intronic
961083793 3:124049032-124049054 AACCAGTCCCTGTTCTCTGAAGG + Intergenic
961311289 3:126003754-126003776 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
963073913 3:141328929-141328951 GAGCATTCCCTGAGCCCTCCAGG + Intronic
963250088 3:143095342-143095364 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
966854303 3:184183785-184183807 GAGCAGCCCCTGGGCTCCCTGGG + Exonic
968621325 4:1604635-1604657 GTGCAGTCCCTGTGCTGTCCTGG - Intergenic
968871104 4:3243014-3243036 GAGAAGGCCCTGTGCCCTAAAGG + Exonic
972128461 4:35800808-35800830 CAGGCATCCCTGTGCTCTCAGGG + Intergenic
972358398 4:38303776-38303798 CAGGCATCCCTGTGCTCTCATGG - Intergenic
974432471 4:61816850-61816872 CAGCCATCCCTGAGCTCTCAGGG + Intronic
980282175 4:130736613-130736635 CAGAAATCCCTGTGCTCTCAGGG + Intergenic
981255354 4:142654907-142654929 GATCACTCCCTGTGCACCCATGG + Intronic
984191649 4:176613111-176613133 CAGCTGTCTCTGTTCTCTCAAGG + Intergenic
985136380 4:186790186-186790208 GAGCAGTCCAGGTCTTCTCAGGG - Intergenic
988642022 5:33050352-33050374 GAGCTGTCACTATGCTCTCTTGG + Intergenic
988854066 5:35209989-35210011 GACCAGTCCCCAAGCTCTCAAGG - Intronic
989258916 5:39397279-39397301 CTGGAGTCCCTGTGCTCTGAGGG - Intronic
990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG + Intronic
992156701 5:73962542-73962564 CAGCAATCCCTGTAGTCTCATGG + Intergenic
992223594 5:74596955-74596977 CAGCAATCCCTGTGCACTTACGG + Intergenic
993685709 5:90934632-90934654 CAGTGGTCCCTGTGATCTCAAGG - Intronic
997588055 5:135055855-135055877 CAGAAGTCACTGTGCTCTCAGGG + Intronic
1002127836 5:177060091-177060113 TCCCAGTCCCAGTGCTCTCAGGG - Intronic
1002442438 5:179271401-179271423 GACCAGCCCCTGAGCTCTCGGGG + Intronic
1003260639 6:4512447-4512469 GAGCAGTGCCTGCGGTCTCCTGG - Intergenic
1003357760 6:5390430-5390452 GAGCAGTCCCTGTGGTTACCTGG - Intronic
1005828942 6:29655124-29655146 GAGCAGTCCCTTGGCTGACATGG - Intergenic
1006142004 6:31935173-31935195 GGGCAGTTTCTGTGCTCTCTTGG + Intronic
1006932459 6:37696454-37696476 GAGCCGACCGGGTGCTCTCAAGG + Intronic
1007694760 6:43725139-43725161 GAGCGGGCCCTGTGCACTCCAGG + Intergenic
1009558258 6:65203053-65203075 GGGCAGTGCCTGGACTCTCAGGG - Intronic
1016936825 6:149454107-149454129 GACCAGACCCTGTGCCCCCAGGG - Intronic
1017373108 6:153736085-153736107 CAGGAATCCCTGTGCTCTCAGGG - Intergenic
1017889224 6:158625299-158625321 GACCAGTCCCTGGGCCCTCAAGG - Intronic
1019074938 6:169379497-169379519 GATCAGTCTCTGGGCTGTCATGG + Intergenic
1019164678 6:170090147-170090169 GGGCACTCCCTCTGCTCCCAGGG + Intergenic
1019427791 7:985505-985527 AACCAGCCCCTGTGCTCTCCAGG + Intronic
1019636075 7:2076378-2076400 GACCAGCCCCTGTCCTCACAGGG - Intronic
1021264737 7:18506227-18506249 GAGCTCTCCCTTTTCTCTCAAGG - Intronic
1022230297 7:28407703-28407725 CATCAGTCCCTGTGGTTTCAAGG + Intronic
1024623865 7:51187913-51187935 GAGCCTTCCCTGAGCTGTCAAGG - Intronic
1026856334 7:73757629-73757651 GAGCATGGCCTGTGCTCACAGGG + Intergenic
1027735026 7:81920912-81920934 CAGGTATCCCTGTGCTCTCAGGG - Intergenic
1031061308 7:117054383-117054405 GAGCAGTTCCTGATCTCTGAAGG - Intronic
1034355022 7:150444837-150444859 GAGCAGCACCTGTGCTCAGAAGG - Intergenic
1034445128 7:151110202-151110224 GAGCATGCACTGTGCTCCCAGGG - Intronic
1034466957 7:151235436-151235458 GAGCAGGCCCGGTACTGTCATGG + Exonic
1034548918 7:151808007-151808029 GGGCGGTCCCTGTGCTCACTTGG - Intronic
1035458676 7:159025716-159025738 GGGAAGTCCTTGTCCTCTCATGG + Intergenic
1035598177 8:878090-878112 GAGGACTCCCAGTACTCTCAAGG - Intergenic
1036887828 8:12572650-12572672 GACCAATCAATGTGCTCTCATGG - Intergenic
1037831999 8:22195310-22195332 GCCCAGTCCATGTGCTCTGAAGG + Intronic
1040288876 8:46114182-46114204 CAGCATTCCCTGTGGTCTCACGG + Intergenic
1040298506 8:46175796-46175818 AAGCATTCCCTGTGGTCTCCCGG - Intergenic
1040309807 8:46231000-46231022 CAGCATTCCCTGTGGTATCACGG - Intergenic
1041474076 8:58243743-58243765 GAGCTGTCCTTTTGCTTTCACGG + Intergenic
1043631922 8:82346156-82346178 AAGCAGTCTCTGTCCTTTCAGGG - Intergenic
1045381794 8:101634721-101634743 CAGCAGTCCTTGTTCACTCAAGG + Intronic
1046949174 8:120003533-120003555 GAGAAGTCCCTGAGCCCTGAAGG + Intronic
1048548056 8:135405174-135405196 CAGGCATCCCTGTGCTCTCAGGG - Intergenic
1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG + Intergenic
1051037528 9:12766657-12766679 GAGCAGTCTCTGTGATCAAAAGG + Intergenic
1051474732 9:17493424-17493446 GATTACTCACTGTGCTCTCAAGG - Intronic
1053533056 9:38900572-38900594 GAACAGCCCCTGTGATGTCAGGG - Intergenic
1054205282 9:62125001-62125023 GAACAGCCCCTGTGATGTCAGGG - Intergenic
1054633079 9:67463369-67463391 GAACAGCCCCTGTGATGTCAGGG + Intergenic
1055572525 9:77631978-77632000 CAGGCATCCCTGTGCTCTCAGGG + Intronic
1057151152 9:92797301-92797323 GAACAGCCCCTGTGATGTCAGGG + Intergenic
1057197040 9:93121033-93121055 GACCAGGCCCTGGACTCTCAGGG - Intergenic
1057227130 9:93298277-93298299 GAGCAGCCCCTGCCCACTCACGG - Intronic
1060673037 9:125486990-125487012 AAGCAGTCCCTGTGTTCTTGGGG - Intronic
1061144750 9:128791113-128791135 CATCAGACCCTGTGCTCTAAAGG - Intronic
1061214956 9:129216396-129216418 GGGCAGACCCTCTGCCCTCAGGG + Intergenic
1189452391 X:41149291-41149313 GAGCAGTACATTTGCTATCAGGG + Intronic
1189901577 X:45712193-45712215 GCTCAGTCCCTGCCCTCTCAGGG - Intergenic
1195677857 X:107521136-107521158 GAGCCCTCCCTGTTCTCTCCTGG + Intergenic
1195700295 X:107700339-107700361 GAGCACAGCCTGTGCTCTCCTGG - Intergenic
1195995657 X:110729246-110729268 AAGCAGTACCTCTGATCTCAGGG - Intronic
1196405977 X:115362874-115362896 GAGCAGCCCCAGTGCTCTTAGGG + Intergenic
1197526793 X:127574823-127574845 CAGGAATCCCTGTGCTCTCGGGG + Intergenic
1199947520 X:152680590-152680612 GAGGAGTCCCAGAGCTCTGAAGG + Intergenic
1199962159 X:152787864-152787886 GAGGAGTCCCAGAGCTCTGAAGG - Intergenic