ID: 990447229

View in Genome Browser
Species Human (GRCh38)
Location 5:55904230-55904252
Sequence CCAGGGAGGGGGGTTCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990447218_990447229 8 Left 990447218 5:55904199-55904221 CCTGTAACAGGTACAATCTGAGA 0: 1
1: 0
2: 0
3: 9
4: 101
Right 990447229 5:55904230-55904252 CCAGGGAGGGGGGTTCCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990447229 Original CRISPR CCAGGGAGGGGGGTTCCCAC TGG Intronic
No off target data available for this crispr