ID: 990450478

View in Genome Browser
Species Human (GRCh38)
Location 5:55928173-55928195
Sequence CCTGAAATCCCACCCTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
990450478_990450480 -9 Left 990450478 5:55928173-55928195 CCAGGGCAGGGTGGGATTTCAGG No data
Right 990450480 5:55928187-55928209 GATTTCAGGCAGAGCCCTGCAGG No data
990450478_990450485 26 Left 990450478 5:55928173-55928195 CCAGGGCAGGGTGGGATTTCAGG No data
Right 990450485 5:55928222-55928244 TCATCCCCAGATGATGCTGGAGG No data
990450478_990450484 23 Left 990450478 5:55928173-55928195 CCAGGGCAGGGTGGGATTTCAGG No data
Right 990450484 5:55928219-55928241 GTCTCATCCCCAGATGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
990450478 Original CRISPR CCTGAAATCCCACCCTGCCC TGG (reversed) Intergenic
No off target data available for this crispr